Previous Contig 003300:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS052G12Sequence619003300 (4)sp|P37142|AKH_DAUCA1e-37Bifunctional aspartokinase/homoserine dehydrogenase, chloroplast precursor (AK-H
JMFS054B07Sequence599003300 (4)sp|P37142|AKH_DAUCA4e-42Bifunctional aspartokinase/homoserine dehydrogenase, chloroplast precursor (AK-H
JMFS073H10Sequence619003300 (4)sp|P37142|AKH_DAUCA4e-43Bifunctional aspartokinase/homoserine dehydrogenase, chloroplast precursor (AK-H
JMFS084C06Sequence618003300 (4)sp|P37142|AKH_DAUCA2e-38Bifunctional aspartokinase/homoserine dehydrogenase, chloroplast precursor (AK-H

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS054B07+ AACTAGCAAGCTCATCT
JMFS073H10+ TGGAGCTTAGATAAANAACTAGCAAGCTCATCT
JMFS084C06+ AACTAGCAAGCTCATCT
JMFS052G12+ AACTAGCAAGCTCATCT
                      ____________________________________________________________
consensus TGGAGCTTAGATAAANAACTAGCAAGCTCATCT
 
. : . : . : . : . : . :
JMFS054B07+ CCATCTAGCAGATCTACTGCTGTTAACTTATGTTTTTCAAGAACAGCATCTAATGCAGTT
JMFS073H10+ CCATCTAGCAGATCTACTGCTGTTAACTTATGTTTTTCAAGAACAGCATCTAATGCAGTT
JMFS084C06+ CCATCTAGCAGATCTACTGCTGTTAACTTATGTTTTTCAAGAACAGCATCTAATGCAGTT
JMFS052G12+ CCATCTAGCAGATCTACTGCTGTTAACTTATG-TTTTCAAGAACAGCATCTAATGCAGTT
                      ____________________________________________________________
consensus CCATCTAGCAGATCTACTGCTGTTAACTTATGTTTTTCAAGAACAGCATCTAATGCAGTT
 
. : . : . : . : . : . :
JMFS054B07+ ATATATGAGTCATCTCTGGACTCTGCTTTATGAATCAGATCATACATCATATCCGTCACT
JMFS073H10+ ATATATGAGTCATCTCTGGACTCTGCTTTATGAATCAGATCATACATCATATCCGTCACT
JMFS084C06+ ATATATGAGTCATCTCTGGA--CTGCTTTATGAATCAGATCATACATCATATCCGTCACT
JMFS052G12+ ATATATGAGTCATCTCTGGACTCTGCTTTATGAATCAGATCATACATCATATCCGTCACT
                      ____________________________________________________________
consensus ATATATGAGTCATCTCTGGACTCTGCTTTATGAATCAGATCATACATCATATCCGTCACT
 
. : . : . : . : . : . :
JMFS054B07+ TTTGACATTGCAGACACAACAACCAGCTTTCTTTCTGATTGGTCTTTAACAATAACATTT
JMFS073H10+ TTTGACATTGCAGACACAACAACCAGCTTTCTTTCTGATTGGTCTTTAACAATAACATTT
JMFS084C06+ TTTGACATTGCAGACACAACAACCAGCTTTCTTTCTGATTGGTCTTTAACAATAACATTT
JMFS052G12+ TTTGACATTGCAGACACAACAACCAGCTTTCTTTCTGATTGGTCTTTAACAATAACATTT
                      ____________________________________________________________
consensus TTTGACATTGCAGACACAACAACCAGCTTTCTTTCTGATTGGTCTTTAACAATAACATTT
 
. : . : . : . : . : . :
JMFS054B07+ GCAACATTGCGGATCCTGTCTGAGTTTCCCACACAGGTACCCCCAAATTTATGTACACCC
JMFS073H10+ GCAACATTGCGGATCCTGTCTGAGTTTCCCACACAGGTACCCCCAAATTTATGTACACCC
JMFS084C06+ GCAACATTGCGGATCCTGTCTGAGTTTCCCACACAGGTACCCCCAAATTTATGTACACCC
JMFS052G12+ GCAACATTGCGGATCCTGTCTGAGTTTCCCACACAGGTACCCCCAAATTTATGTACACCC
                      ____________________________________________________________
consensus GCAACATTGCGGATCCTGTCTGAGTTTCCCACACAGGTACCCCCAAATTTATGTACACCC
 
. : . : . : . : . : . :
JMFS054B07+ CAACTATCACCCTTTGGAAGCTGAATTTTCTCTATAGTTTCCTCAGCAGTGCGCTCTGGG
JMFS073H10+ CAACTATCACCCTTTGGAAGCTGAATTTTCTCTATAGTTTCCTCAGCAGTGCGCTCTGGG
JMFS084C06+ CAACTATCACCCTTTGGAAGCTGAATTTTCTCTATAGTTTCCTCAGCAGTGCGCTCTGGG
JMFS052G12+ CAACTATCACCCTTTGGAAGCTGAATTTTCTCTATAGTTTCCTCAGCAGTGCGCTCTGGG
                      ____________________________________________________________
consensus CAACTATCACCCTTTGGAAGCTGAATTTTCTCTATAGTTTCCTCAGCAGTGCGCTCTGGG
 
. : . : . : . : . : . :
JMFS054B07+ CTAATAATAGCAGAATATACGCTGAAACTTGATAATTCTCTTCTTCCCCCATGGGTATTA
JMFS073H10+ CTAATAATAGCAGAATATACGCTGAAACTTGATAATTCTCTTCTTCCCCCATGGGTATTA
JMFS084C06+ CTAATAATAGCAGAATATACGCTGAAACTTGATAATTCTCTTCTTCCCCCATGGGTATTA
JMFS052G12+ CTAATAATAGCAGAATATACGCTGAAACTTGATAATTCTCTTCTTCCCCCATGGGTATTA
                      ____________________________________________________________
consensus CTAATAATAGCAGAATATACGCTGAAACTTGATAATTCTCTTCTTCCCCCATGGGTATTA
 
. : . : . : . : . : . :
JMFS054B07+ AATTCAAGTTTAGAGAAAGCGGAGCGGGGGAGGGCAGAGAAAGGGCAGATCTTGTGCATG
JMFS073H10+ AATTCAAGTTTAGAGAAAGCGGAGCGGGGGAGGGCAGAGAAAGGGCAGATCTTGTGCATG
JMFS084C06+ AATTCAAGTTTAGAGAAAGCGGAGCGGGGGAGGGCAGAGAAAGGGCAGATCTTGTGCATG
JMFS052G12+ AATTCAAGTTTAGAGAAAGCGGAGCGGGGGAGGGCAGAGAAAGGGCAGATCTTGTGCATG
                      ____________________________________________________________
consensus AATTCAAGTTTAGAGAAAGCGGAGCGGGGGAGGGCAGAGAAAGGGCAGATCTTGTGCATG
 
. : . : . : . : . : . :
JMFS054B07+ TCGGCGGGGGGCGTCTTCTTAGCTTTAGGCCGGACATTGGCGGCTCCCAATAATGGGTTG
JMFS073H10+ TCGGCGGGGGGCGTCTTCTTAGCTTTAGGCCGGACATTGGCGGCTCCCAATAATGGGTTG
JMFS084C06+ TCGGCGGGGGGCGTCTTCTTAGCTTTAGGCCGGACATTGGCGGCTCCCAATAATGGGTTG
JMFS052G12+ TCGGCGGGGGGCGTCTTCTTAGCTTTAGGCCGGACATTGGCGGCTCCCAATAATGGGTTG
                      ____________________________________________________________
consensus TCGGCGGGGGGCGTCTTCTTAGCTTTAGGCCGGACATTGGCGGCTCCCAATAATGGGTTG
 
. : . : . : . : . : . :
JMFS054B07+ GAGGAGAGCTTGCACGGAGAAATCGAAGACGAGAACGCCATTATTGTAGGCTCTGCAGTG
JMFS073H10+ GAGGAGAGCTTGCACGGAGAAATCGAAGACGAGAACGCCATTATTGTAGGCTCTGCAGTG
JMFS084C06+ GAGGAGAGCTTGCACGGAGAAATCGAAGACGAGAACGCCATTATTGTAGGCTCTGCAGTG
JMFS052G12+ GAGGAGAGCTTGCACGGAGAAATCGAAGACGAGAACGCCATTATTGTAGGCTCTGCAGTG
                      ____________________________________________________________
consensus GAGGAGAGCTTGCACGGAGAAATCGAAGACGAGAACGCCATTATTGTAGGCTCTGCAGTG
 
. : . : . : . : . : . :
JMFS054B07+ AAGCTCAAGTGTTTGCAGAGNCCCCAGGTGTCTGGTAGCGG
JMFS073H10+ AAGCTCAAGTGTTTGCAGAGCNCCCAGGTGTCTGGTAGCGG
JMFS084C06+ AAGCTCAAGTGTTTGCAGAGNCCCCAGGTGTCTGGTAGCGGGTTGATACGGAAGAAATGG
JMFS052G12+ AAGCTCAAGTGTTTGCAGAGNCCCCAGGTGTCTGGTAGCGGGTTGATACGGAAGAAATGG
                      ____________________________________________________________
consensus AAGCTCAAGTGTTTGCAGAGCCCCCAGGTGTCTGGTAGCGGGTTGATACGGAAGAAATGG