Previous Contig 003290:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS042C02Sequence611003290 (4)
JMFS043H04Sequence627003290 (4)gb:AB112672_15271903e-28Cucumis sativus CsARF2 mRNA for auxin response factor 2, complete cds.
JMFS044D06Sequence632003290 (4)gb:AB112672_15271903e-07Cucumis sativus CsARF2 mRNA for auxin response factor 2, complete cds.
JMFS051E06Sequence611003290 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS043H04+ ATGCAGGGTGACATTATGNAGGTAGC
                      ____________________________________________________________
consensus ATGCAGGGTGACATTATGNAGGTAGC
 
. : . : . : . : . : . :
JMFS043H04+ ATATTAGCATTGAGGGAAGGTTGGGGTAGTTCGGAATTTGAGCATCCACGTCTTTCTTCA
                      ____________________________________________________________
consensus ATATTAGCATTGAGGGAAGGTTGGGGTAGTTCGGAATTTGAGCATCCACGTCTTTCTTCA
 
. : . : . : . : . : . :
JMFS043H04+ TAGACGCAGCAACCTGTTCGCTGTGGCCCTGGGGGAAGTAGACGACGTGGGTCCCGGCCG
JMFS044D06+ AGTAGACGACGTGGGTCCCGGCCG
                      ____________________________________________________________
consensus TAGACGCAGCAACCTGTTCGCTGTGGCCCTGGGGGAAGTAGACGACGTGGGTCCCGGCCG
 
. : . : . : . : . : . :
JMFS043H04+ CCGGCAAGTTCACCAGCGGTCCGGCGCAGGCCTGCCATAGCTCTGGGTTTATGCTCTTCT
JMFS044D06+ CCGGCAAGTTCACCAGCGGTCCGGCGCAGGCCTGCCATAGCTCTGGGTTTATGCTCTTCT
                      ____________________________________________________________
consensus CCGGCAAGTTCACCAGCGGTCCGGCGCAGGCCTGCCATAGCTCTGGGTTTATGCTCTTCT
 
. : . : . : . : . : . :
JMFS043H04+ TCTCA---GCTTCAGGTGGGTTGGCGTTAGCCGCCGGCGGTGGCGTCTTCATTGCAGTAC
JMFS044D06+ TCTCAGCTGCTTCAGGTGGGTTGGCGTTAGCCGCCGGCGGTGGCGTCTTCATTGCAGTAC
JMFS042C02+ GCTTCAGGTGGGTTGGCGTTAGCCGCCGGCGGTGGCGTCTTCATTGCAGTAC
                      ____________________________________________________________
consensus TCTCAGCTGCTTCAGGTGGGTTGGCGTTAGCCGCCGGCGGTGGCGTCTTCATTGCAGTAC
 
. : . : . : . : . : . :
JMFS043H04+ TTCAACCGCC-AAAAAAAAAACTCACTTTCCGAGCTGCAAACAAACACCCAGATAACCCT
JMFS044D06+ TTCAACCGCCAAAAAAAAAAACTCACTTTCCGAGCTGCAAACAAACACCCAGATAACCCT
JMFS042C02+ TTCAACCGCCAAAAAAAAAAACTCACTTTCCGAGCTGCAAACAAACACCCAGATAACCCT
JMFS051E06+ TTCAACCGCC-AAAAAAAAAACTCACTTTCCGAGCTGCAAACAAACACCCAGATAACCCT
                      ____________________________________________________________
consensus TTCAACCGCCAAAAAAAAAAACTCACTTTCCGAGCTGCAAACAAACACCCAGATAACCCT
 
. : . : . : . : . : . :
JMFS043H04+ TACCGGAGATTCATATCTGCCTTCAGTAAATCGGAGCTCCGACACCCCAACTCCGGCTGG
JMFS044D06+ TACCGGAGATTCATATCTGCCTTCAGTAAATCGGAGCTCCGACACCCCAACTCCGGCTGG
JMFS042C02+ TACCGGAGATTCATATCTGCCTTCAGTAAATCGGAGCTCCGACACCCCAACTCCGGCTGG
JMFS051E06+ TACCGGAGATTCATATCTGCCTTCAGTAAATCGGAGCTCCGACACCCCAACTCCGGCTGG
                      ____________________________________________________________
consensus TACCGGAGATTCATATCTGCCTTCAGTAAATCGGAGCTCCGACACCCCAACTCCGGCTGG
 
. : . : . : . : . : . :
JMFS043H04+ AAAGCACGAATCTTGATTTATCAAAACATAGACTTTTTGTTTCCCTAAGCTCCCCCACTA
JMFS044D06+ AAAGCACGAATCTTGATTTATCAAAACATAGACTTTTTGTTTCCCTAAGCTCCCCCACTA
JMFS042C02+ AAAGCACGAATCTTGATTTATCAAAACATAGACTTTTTGTTTCCCTAAGCTCCCCCACTA
JMFS051E06+ AAAGCACGAATCTTGATTTATCAAAACATAGACTTTTTGTTTCCCTAAGCTCCCCCACTA
                      ____________________________________________________________
consensus AAAGCACGAATCTTGATTTATCAAAACATAGACTTTTTGTTTCCCTAAGCTCCCCCACTA
 
. : . : . : . : . : . :
JMFS043H04+ GGAAAAGGCAAGCTAAGGAAAAAGAAGTCCCAAGCTAGTAGTCTACTATTGTATTAAACA
JMFS044D06+ GGAAAAGGCAAGCTAAGGAAAAAGAAGTCCCAAGCTAGTAGTCTACTATTGTATTAAACA
JMFS042C02+ GGAAAAGGCAAGCTAAGGAAAAAGAAGTCCCAAGCTAGTAGTCTACTATTGTATTAAACA
JMFS051E06+ GGAAAAGGCAAGCTAAGGAAAAAGAAGTCCCAAGCTAGTAGTCTACTATTGTATTAAACA
                      ____________________________________________________________
consensus GGAAAAGGCAAGCTAAGGAAAAAGAAGTCCCAAGCTAGTAGTCTACTATTGTATTAAACA
 
. : . : . : . : . : . :
JMFS043H04+ AAAGAGATTAACCGGAATCGGAGGAAGGGAGTTCCCGGCGGCGGGAAGTGTGGCCGGAAA
JMFS044D06+ AAAGAGATTAACCGGAATCGGAGGAAGGGAGTTCCCGGCGGCGGGAAGTGTGGCCGGAAA
JMFS042C02+ AAAGAGATTAACCGGAATCGGAGGAAGGGAGTTCCCGGCGGCGGGAAGTGTGGCCGGAAA
JMFS051E06+ AAAGAGATTAACCGGAATCGGAGGAAGGGAGTTCCCGGCGGCGGGAAGTGTGGCCGGAAA
                      ____________________________________________________________
consensus AAAGAGATTAACCGGAATCGGAGGAAGGGAGTTCCCGGCGGCGGGAAGTGTGGCCGGAAA
 
. : . : . : . : . : . :
JMFS043H04+ ATGCGGTAGAGAGAGAAAGATGTAAGGGGAGACAAGAGGAGCTTTGGAAAAGGAAGGGAT
JMFS044D06+ ATGCGGTAGAGAGAGAAAGATGTAAGGGGAGACAAGAGGAGCTTTGGAAAAGGAAGGGAT
JMFS042C02+ ATGCGGTAGAGAGAGAAAGATGTAAGGGGAGACAAGAGGAGCTTTGGAAAAGGAAGGGAT
JMFS051E06+ ATGCGGTAGAGAGAGAAAGATGTAAGGGGAGACAAGAGGAGCTTTGGAAAAGGAAGGGAT
                      ____________________________________________________________
consensus ATGCGGTAGAGAGAGAAAGATGTAAGGGGAGACAAGAGGAGCTTTGGAAAAGGAAGGGAT
 
. : . : . : . : . : . :
JMFS043H04+ GTTGA
JMFS044D06+ GTTGAGGATTGCAGAGACCAAATGCTGCAATTCTACTTTTAACTGCCCCCTATACAGATA
JMFS042C02+ GTTGAGGATTGCAGAGACCAAATGCTGCAATTCTACTTTTAACTGCCCCCTATACAGATA
JMFS051E06+ GTTGAGGATTGCAGAGACCAAATGCTGCAATTCTACTTTTAACTGCCCCCTATACAGATA
                      ____________________________________________________________
consensus GTTGAGGATTGCAGAGACCAAATGCTGCAATTCTACTTTTAACTGCCCCCTATACAGATA
 
. : . : . : . : . : . :
JMFS044D06+ CACCCTTCAGACACACTACTTTCTCTCTCTAGAAATCCAAGCCCCTTGCCTTCTCCCTTC
JMFS042C02+ CACCCTTCAGACACACTACTTTCTCTCTCTAGAAATCCAAGCCCCTTGCCTTCTCCCTTC
JMFS051E06+ CACCCTTCAGACACACTACTTTCTCTCTCTAGAAATCCAAGCCCCTTGCCTTCTCCCTTC
                      ____________________________________________________________
consensus CACCCTTCAGACACACTACTTTCTCTCTCTAGAAATCCAAGCCCCTTGCCTTCTCCCTTC
 
. : . : . : . : . : . :
JMFS044D06+ CAGTTCTC
JMFS042C02+ CAGTTCTCTTTCTCTCTCTCTATCTTTCTTTGTTATTCTTCTTGTTCTTCACAAAGCTTC
JMFS051E06+ CAGTTCTCTTTCTCTCTCTCTATCTTTCTTTGTTATTCTTCTTGTTCTTCACAAAGCTTC
                      ____________________________________________________________
consensus CAGTTCTCTTTCTCTCTCTCTATCTTTCTTTGTTATTCTTCTTGTTCTTCACAAAGCTTC
 
. : . : . : . : . : . :
JMFS042C02+ CCTTTTTCTATCTC
JMFS051E06+ CCTTTTTCTATCTCTATCTCTATTGTTCCCAAAGCTAGCTTTCTTTAATCTTTTACTTTC
                      ____________________________________________________________
consensus CCTTTTTCTATCTCTATCTCTATTGTTCCCAAAGCTAGCTTTCTTTAATCTTTTACTTTC