Previous Contig 003287:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS050G03Sequence610003287 (2)gb:AC113948_17390977e-86Oryza sativa chromosome 10 BAC OSJNBb0038A07 genomic sequence, complete sequence
JMFS126F05Sequence624003287 (2)pir|F71429|F714299e-82hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV43_1545433 Arabidopsis tha

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS126F05+ CCAGATGACCCCACAGCAACGTAAGAGT
                      ____________________________________________________________
consensus CCAGATGACCCCACAGCAACGTAAGAGT
 
. : . : . : . : . : . :
JMFS126F05+ AAGCTCCATAGCTGTAAGGGTCCCTTCCCCAGTCAGTCACCACAGATGCAACTGGATTGG
                      ____________________________________________________________
consensus AAGCTCCATAGCTGTAAGGGTCCCTTCCCCAGTCAGTCACCACAGATGCAACTGGATTGG
 
. : . : . : . : . : . :
JMFS126F05+ GTACCCTGCTCTCACCAAAAAGTTTGCGAAGCACCGATAGGGCATGGTTTACATGATCAG
JMFS050G03+ ACATGATCAG
                      ____________________________________________________________
consensus GTACCCTGCTCTCACCAAAAAGTTTGCGAAGCACCGATAGGGCATGGTTTACATGATCAG
 
. : . : . : . : . : . :
JMFS126F05+ ATGAACCAATATGTTGACCATCTAAAGCTGCTTTTCCAACCACCAAGGCTATAAGGACAG
JMFS050G03+ ATGAACCAATATGTTGACCATCTAAAGCTGCTTTTCCAACCACCAAGGCTATAAGGACAG
                      ____________________________________________________________
consensus ATGAACCAATATGTTGACCATCTAAAGCTGCTTTTCCAACCACCAAGGCTATAAGGACAG
 
. : . : . : . : . : . :
JMFS126F05+ GTGCACCAACGGTTTTTCTAACATTCCAGAACATAAAGCATTGCCCTCTACGATCTGTTT
JMFS050G03+ GTGCACCAACGGTTTTTCTAACATTCCAGAACATAAAGCATTGCCCTCTACGATCTGTTT
                      ____________________________________________________________
consensus GTGCACCAACGGTTTTTCTAACATTCCAGAACATAAAGCATTGCCCTCTACGATCTGTTT
 
. : . : . : . : . : . :
JMFS126F05+ CTTCAGCAGTTGCACCAAAGTAATCAACTGAGTCATCCCAAAAAACCTCAGGAAACTCCA
JMFS050G03+ CTTCAGCAGTTGCACCAAAGTAATCAACTGAGTCATCCCAAAAAACCTCAGGAAACTCCA
                      ____________________________________________________________
consensus CTTCAGCAGTTGCACCAAAGTAATCAACTGAGTCATCCCAAAAAACCTCAGGAAACTCCA
 
. : . : . : . : . : . :
JMFS126F05+ AAACAACTTTATTAAGAACCCCAAAACCAAGCCGCTGAATTGACAAAGATTTCCAATGGG
JMFS050G03+ AAACAACTTTATTAAGAACCCCAAAACCAAGCCGCTGAATTGACAAAGATTTCCAATGGG
                      ____________________________________________________________
consensus AAACAACTTTATTAAGAACCCCAAAACCAAGCCGCTGAATTGACAAAGATTTCCAATGGG
 
. : . : . : . : . : . :
JMFS126F05+ GCAAGGGGGGTGTAAAGTTAATGGCTCCTGCCTTAAGACACCCAAGCGGTACTGTAATCA
JMFS050G03+ GCAAGGGGGGTGTAAAGTTAATGGCTCCTGCCTTAAGACACCCAAGCGGTACTGTAATCA
                      ____________________________________________________________
consensus GCAAGGGGGGTGTAAAGTTAATGGCTCCTGCCTTAAGACACCCAAGCGGTACTGTAATCA
 
. : . : . : . : . : . :
JMFS126F05+ GAACGGCATCCCCTGAGAACTCTTTTCCATTGGATGTGGAAACTTTGACCTTGTTAGTTA
JMFS050G03+ GAACGGCATCCCCTGAGAACTCTTTTCCATTGGATGTGGAAACTTTGACCTTGTTAGTTA
                      ____________________________________________________________
consensus GAACGGCATCCCCTGAGAACTCTTTTCCATTGGATGTGGAAACTTTGACCTTGTTAGTTA
 
. : . : . : . : . : . :
JMFS126F05+ ATCCATCGCTGGTTATACTACTCTCAGTGTTATACATAATATCAGTTACAGCATGATTAA
JMFS050G03+ ATCCATCGCTGGTTATACTACTCTCAGTGTTATACATAATATCAGTTACAGCATGATTAA
                      ____________________________________________________________
consensus ATCCATCGCTGGTTATACTACTCTCAGTGTTATACATAATATCAGTTACAGCATGATTAA
 
. : . : . : . : . : . :
JMFS126F05+ AGTGTATCCTTAGGCCTTCTCCAAGTGATTCAACAACAGCACTGTAACCCCCTTTA
JMFS050G03+ AGTGTATCCTTAGGCCTTCTCCAAGTGATTCAACAACAGCACTGTAACCCCCTTTAATCA
                      ____________________________________________________________
consensus AGTGTATCCTTAGGCCTTCTCCAAGTGATTCAACAACAGCACTGTAACCCCCTTTAATCA
 
. : . : . : . : . : . :
JMFS050G03+ TGCAGTGTGCTCCTCCAAAACCTCCATATACATCATCTTGATTCCAATGAGGAAGAGAAA
                      ____________________________________________________________
consensus TGCAGTGTGCTCCTCCAAAACCTCCATATACATCATCTTGATTCCAATGAGGAAGAGAAA
 
. : . : . : . : . : . :
JMFS050G03+ CTTCCTTGAGCAATGCTGCGCATCCATACTCCAAGTTTGCAAAGTGCCAATCCATTACCC
                      ____________________________________________________________
consensus CTTCCTTGAGCAATGCTGCGCATCCATACTCCAAGTTTGCAAAGTGCCAATCCATTACCC