Previous Contig 003281:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS006H04Sequence572003281 (9)gb:AC105364_17379768e-39Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete se
JMFS031D03Sequence560003281 (9)gb:AC105364_17379766e-46Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete se
JMFS042C12Sequence640003281 (9)gb:AC105364_17379762e-89Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete se
JMFS049H04Sequence606003281 (9)gb:AC105364_17379767e-15Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete se
JMFS098G05Sequence638003281 (9)gb:AC105364_17379768e-57Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete se
JMFS140C10Sequence625003281 (9)gb:AC105364_17379765e-55Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete se
JMSF014D23Sequence156003281 (9)711012062 (3)gb:AY080803_15685022e-05Arabidopsis thaliana unknown protein (At2g01690) mRNA, partial cds.
JMSF018L10Sequence557003281 (9)gb:AC105364_17379762e-22Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete se771012062 (3)gb:AY080803_15685025e-17Arabidopsis thaliana unknown protein (At2g01690) mRNA, partial cds.
JMSF019C14Sequence384003281 (9)gb:AC105364_17379763e-10Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete se773012062 (3)gb:AY080803_15685022e-17Arabidopsis thaliana unknown protein (At2g01690) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS042C12+ CTTAGCATATTANATAAACCATCAAGGAAATCAGGAAGGAA
                      ____________________________________________________________
consensus CTTAGCATATTANATAAACCATCAAGGAAATCAGGAAGGAA
 
. : . : . : . : . : . :
JMFS042C12+ ACCAAGCATATCTATATCTGGAACACTGTCTAATACTGTGATCCACCCGACCAAAAATTG
                      ____________________________________________________________
consensus ACCAAGCATATCTATATCTGGAACACTGTCTAATACTGTGATCCACCCGACCAAAAATTG
 
. : . : . : . : . : . :
JMFS042C12+ CCGCACATAAGGATTGAGGACATTCATCCGTTCTCTCAACAATGGTATAAATTCTTCAAT
                      ____________________________________________________________
consensus CCGCACATAAGGATTGAGGACATTCATCCGTTCTCTCAACAATGGTATAAATTCTTCAAT
 
. : . : . : . : . : . :
JMFS042C12+ GCTGAATTGATCACTCTCAGTGACAATATCCTTCACAAGTCTATCTAAAAGATGTGCAGC
                      ____________________________________________________________
consensus GCTGAATTGATCACTCTCAGTGACAATATCCTTCACAAGTCTATCTAAAAGATGTGCAGC
 
. : . : . : . : . : . :
JMFS042C12+ ACTTTGCACACTGGAATCTGAGTCTGCTGAGAGTTTGCACAAAGCATCAAAGATCTCATT
                      ____________________________________________________________
consensus ACTTTGCACACTGGAATCTGAGTCTGCTGAGAGTTTGCACAAAGCATCAAAGATCTCATT
 
. : . : . : . : . : . :
JMFS042C12+ GAAAAACACAATAAAATCTCCTCTTACGACCTTGGCTATGTTATACAGGGCTTCACAAGC
JMFS031D03+ GC
JMFS098G05+ GCTATATTATACAGAGCTTCACAGGC
JMFS140C10+ ACCTTTGCTATATTATACAGAGCTTCACAGGC
                      ____________________________________________________________
consensus GAAAAACACAATAAAATCTCCTCTTACGACCTTTGCTATATTATACAGAGCTTCACAGGC
 
. : . : . : . : . : . :
JMFS042C12+ ATAATAGCGAACTCTGCTATCTTGATCAGAAAAGGAATTGAGGACTGGTGGTACTATTTT
JMFS031D03+ ATAATAACGAACTCTACTATCTTGATCCGAAAAGGAGTTCAGTACAGGTGGCACAATTTG
JMFS098G05+ ATAATAACGAACTCTACTATCTTGATCCGAAAAGGAGTTCAGTACAGGTGGCACAATTTG
JMFS140C10+ ATAATAACGAACTCTACTATCTTGATCCGAAAAGGAGTTCAGTACAGGTGGCACAATTTG
JMFS006H04+ AGTTCAGTACAGGTGGCACAATTTG
                      ____________________________________________________________
consensus ATAATAACGAACTCTACTATCTTGATCCGAAAAGGAGTTCAGTACAGGTGGCACAATTTG
 
. : . : . : . : . : . :
JMFS042C12+ CTCAAGATGCTGTGCTGCTTCAGTAGTCAAACCCACAGTTGCGGCAGCTAAACCTATCAA
JMFS031D03+ CTCAAGATGCTGAGCTGCTTCAGAAGTCAAACCCACAGTTGCAGCAGCTAACCCTATCAA
JMFS098G05+ CTCAAGATGCTGAGCTGCTTCAGAAGTCAAACCCACAGTTGCAGCAGCTAACCCTATCAA
JMFS140C10+ CTCAAGATGCTGAGCTGCTTCAGAAGTCAAACCCACAGTTGCAGCAGCTAACCCTATCAA
JMFS006H04+ CTCAAGATGCTGAGCTGCTTCAGAAGTCAAACCCACAGTTGCAGCAGCTAACCCTATCAA
                      ____________________________________________________________
consensus CTCAAGATGCTGAGCTGCTTCAGAAGTCAAACCCACAGTTGCAGCAGCTAACCCTATCAA
 
. : . : . : . : . : . :
JMFS042C12+ TCCTCCTTTCCGGTGATTTGCTTGGGGAGAGTAGGTAAACTCATGGGTCAACAAATGGAT
JMFS031D03+ TCCTCCTTTCCGGTGATTGGCTTGGGGAGAGTAGGTATACTCCTCGGTCAACAAATTGAT
JMFS098G05+ TCCTCCTTTCCGGTGATTGGCTTGGGGAGAGTAGGTATACTCCTCGGTCAACAAATTGAT
JMFS140C10+ TCCTCCTTTCCGGTGATTGGCTTGGGGAGAGTAGGTATACTCCTCGGTCAACAAATTGAT
JMFS006H04+ TCCTCCTTTCCGGTGATTGGCTTGGGGAGAGTAGGTATACTCCTCGGTCAACAAATTGAT
JMSF018L10+ TCCGGTGATTGGCTTGGGGAGAGTAGGTATACTCCTCGGTCAACAAATTGAT
JMFS049H04+ AAATTGAT
                      ____________________________________________________________
consensus TCCTCCTTTCCGGTGATTGGCTTGGGGAGAGTAGGTATACTCCTCGGTCAACAAATTGAT
 
. : . : . : . : . : . :
JMFS042C12+ CACGGCATTAATCTTGTCGTGATCAGCCGCCGCTACCAATTGCTTCACAATCCCTTCCAC
JMFS031D03+ CACAGCAGTAATCTTGTCGTGATCACCAGCTCCAGCCAACTGTTTCACTATCCCCTCCAA
JMFS098G05+ CACAGCAGTAATCTTGTCGTGATCACCAGCTCCAGCCAACTGTTTCACTATCCCCTCCAA
JMFS140C10+ CACAGCAGTAATCTTGTCGTGATCACCAGCTCCAGCCAACTGTTTCACTATCCCCTCCAA
JMSF019C14+ CTCCAGCCAACTGNTTCACTATCCCCTCCAA
JMFS006H04+ CACAGCAGTAATCTTGTCGTGATCACCAGCTCCAGCCAACTGTTTCACTATCCCCTCCAA
JMSF018L10+ CACAGCAGTAATCTTGTCGTGATCACCAGCTCCAGCCAACTGTTTCACTATCCCCTCCAA
JMFS049H04+ CACAGCAGTAATCTTGTCGTGATCACCAGCTCCAGCCAACTGTTTCACTATCCCCTCCAA
                      ____________________________________________________________
consensus CACAGCAGTAATCTTGTCGTGATCACCAGCTCCAGCCAACTGTTTCACTATCCCCTCCAA
 
. : . : . : . : . : . :
JMFS042C12+ CTCGAGAGCCGCATTCTTGCGCTTCTCGTAGAGCTTATCGGAGA
JMFS031D03+ CTCCAGAGCTGCATTCTTGCGCTTCTCGTAGAGCTTATCAGAGAGGTTCCGGAGAACCGC
JMFS098G05+ CTCCAGAGCTGCATTCTTGCGCTTCTCGTAGAGCTTATCAGAGAGGTTCCGGAGAACCGC
JMFS140C10+ CTCCAGAGCTGCATTCTTGCGCTTCTCGTAGAGCTTATCAGAGAGGTTCCGGAGAACCGC
JMSF019C14+ CTCCAGAGCTGCATTCTTGCGCTTCTCGTAGAGCTTATCAGAGAGGTTCCGGAGAACCGC
JMFS006H04+ CTCCAGAGCTGCATTCTTGCGCTTCTCGTAGAGCTTATCAGAGAGGTTCCGGAGAACCGC
JMSF018L10+ CTCCAGAGCTGCATTCTTGCGCTTCTCGTAGAGCTTATCAGAGAGGTTCCGGAGAACCGC
JMFS049H04+ CTCCAGAGCTGCATTCTTGCGCTTCTCGTAGAGCTTATCAGAGAGGTTCCNGAGAACCGC
                      ____________________________________________________________
consensus CTCCAGAGCTGCATTCTTGCGCTTCTCGTAGAGCTTATCAGAGAGGTTCCGGAGAACCGC
 
. : . : . : . : . : . :
JMFS031D03+ AGCCGGAATCACAGACAAAGCCTCCGAAGTAGCCATACTAGTCAATTTCACACAAAACCC
JMFS098G05+ AGCCGGAATCACAGACAAAGCCTCCGAAGTAGCCATACTAGTCAATTTCACACAAAACCC
JMFS140C10+ AGCCGGAATCACAGACAAAGCCTCCGAAGTAGCCATACTAGTCAATTTCACACAAAACCC
JMSF019C14+ AGCCGGAATCACAGACAAAGCCTCCGAAGTAGCCATACTAGTCAATTTCACACAAAACCC
JMFS006H04+ AGCCGGAATCACAGACAAAGCCTCCGAAGTAGCCATACTAGTCAATTTCACACAAAACCC
JMSF018L10+ AGCCGGAATCACAGACAAAGCCTCCGAAGTAGCCATACTAGTCAATTTCACACAAAACCC
JMFS049H04+ AGCCGGAATCACAGACAAAGCCTCCGAAGTAGCCATACTAGTCAATTTCACACAAAACCC
                      ____________________________________________________________
consensus AGCCGGAATCACAGACAAAGCCTCCGAAGTAGCCATACTAGTCAATTTCACACAAAACCC
 
. : . : . : . : . : . :
JMFS031D03+ TAGACACAGAAAAAGAAGAAACTATATACACATACAACACACTC-AAACACACAATCAAA
JMFS098G05+ TAGACACAGAAAAAGAAGAAACTATATACACATACAACACACTC-AAACACACAATCAAA
JMFS140C10+ TAGACACAGAAAAAGAAGAAACTATATACACATACAACACACTC-AAACACACAATCAAA
JMSF019C14+ TAGACACAGAAAAAGAAGAAACTATATACACATACAACACACTCAAAACACACAATCAAA
JMFS006H04+ TAGACACAGAAAAAGAAGAAACTATATACACATACAACACACTC-AAACACACAATCAAA
JMSF018L10+ TAGACACAGAAAAAGAAGAAACTATATACACATACAACACACTC-AAACACACAATCAAA
JMFS049H04+ TAGACACAGAAAAAGAAGAAACTATATACACATACAACACACTC-AAACACACAATCAAA
                      ____________________________________________________________
consensus TAGACACAGAAAAAGAAGAAACTATATACACATACAACACACTC-AAACACACAATCAAA
 
. : . : . : . : . : . :
JMFS031D03+ TTCCCTTTCTAATCTCCTCCTCCAGAAGCTGAACCATCCCTCCCCCAATCACCC-TACGT
JMFS098G05+ TTCCCTTTCTAATCTCCTCCTCCAGAAGCTGAACCATCCCTCCCCCAATCACCC-TACGT
JMFS140C10+ TTCCCTTTCTAATCTCCTCCTCCAGAAGCTGAACCATCCCTCCCCCAATCACCC-TACGT
JMSF019C14+ TTCCCTTTCTAATCTCCTCCTCCAGAAGCTGAACCATCCCTCCCCCAATCACCC-TACGT
JMSF014D23+ CCTCCAGAAGCTGAACCATCCCTCCCCCAATCACCCGTACGT
JMFS006H04+ TTCCCTTTCTAATCTCCTCCTCCAGAAGCTGAACCATCCCTCCCCCAATCACCC-TACGT
JMSF018L10+ TTCCCTTTCTAATCTCCTCCTCCAGAAGCTGAACCATCCCTCCCCCAATCACCC-TACGT
JMFS049H04+ TTCCCTTTCTAATCTCCTCCTCCAGAAGCTGAACCATCCCTCCCCCAATCACCC-TACGT
                      ____________________________________________________________
consensus TTCCCTTTCTAATCTCCTCCTCCAGAAGCTGAACCATCCCTCCCCCAATCACCC-TACGT
 
. : . : . : . : . : . :
JMFS031D03+ GTATATATAATATATACACACACATATATATAGGTGGGTATATGTAACTCTGTGGAATAC
JMFS098G05+ GTATATATAATATATACACACACATATATATAGGTGGGTATATGTAACTCTGTGGAATAC
JMFS140C10+ GTATATATAATATATACACACACATATATATAGGTGGGTATATGTAACTCTGTGGAATAC
JMSF019C14+ GTATATATAATATATACACACACATATATATAGGTGGGTATATGTAACTCTGTGGAATAC
JMSF014D23+ GTATATATAATATATACACACACATATATATAGGTGGGTATATGTAACTCTGTGGAATAC
JMFS006H04+ GTATATATAATATATACACACACATATATATAGGTGGGTATATGTAACTCTGTGGAATAC
JMSF018L10+ GTATATATAATATATACACACACATATATATAGGTGGGTATATGTAACTCTGTGGAATAC
JMFS049H04+ GTATATATAATATATACACACACATATATATAGGTGGGTATATGTAACTCTGTGGAATAC
                      ____________________________________________________________
consensus GTATATATAATATATACACACACATATATATAGGTGGGTATATGTAACTCTGTGGAATAC
 
. : . : . : . : . : . :
JMFS031D03+ AAGTGAAGAACAGATCTA
JMFS098G05+ AAGTGAAGAACAGATCTAATGGAGAAGAAAGAAAG
JMFS140C10+ AAGTGAAGAACAGATCTAATGGAGAAGAAAGAAAGAAA
JMSF019C14+ AAGTGAAGAACAGATCTAATGGAGAAGAAAGAAAGAAATGGAAATCAAT
JMSF014D23+ AAGTGAAGAACAGATCTAATGGAGAAGAAAGAAAGAAATGGAAATCAATCCAC
JMFS006H04+ AAGTGAAGAACAGATCTAATGGAGAAGAAAGAAAGAAATGGAAATCAATCCACGATTGAA
JMSF018L10+ AAGTGAAGAACAGATNTAATGGAGAAGAAAGAAAGAAATGGAAATCAATCCACGATTGAA
JMFS049H04+ AAGTGAAGAACAGATCTAATGGAGAAGAAAGAAAGAAATGGAAATCAATCCACGATTGAA
                      ____________________________________________________________
consensus AAGTGAAGAACAGATCTAATGGAGAAGAAAGAAAGAAATGGAAATCAATCCACGATTGAA
 
. : . : . : . : . : . :
JMFS006H04+ TAGATCTTG
JMSF018L10+ TAGATCTTGGGGGTTTCTGTTTTATACAAACCTTTTTTTATTACCCTTTTTGGGGTTTTT
JMFS049H04+ TAGATCTTGGGGGTTTCTGTTTTATACAAACCTTTTTTTATTACCCTTTTTGGGGTTTTT
                      ____________________________________________________________
consensus TAGATCTTGGGGGTTTCTGTTTTATACAAACCTTTTTTTATTACCCTTTTTGGGGTTTTT
 
. : . : . : . : . : . :
JMSF018L10+ TTTTGTTTAATTTGATGAGAGAGACT
JMFS049H04+ TTTTGTTTAATTTGATGAGAGAGACTGAGAGAGAGAGAAGATAGTATGTAAATTTTAAGC
                      ____________________________________________________________
consensus TTTTGTTTAATTTGATGAGAGAGACTGAGAGAGAGAGAAGATAGTATGTAAATTTTAAGC
 
. : . : . : . : . : . :
JMFS049H04+ TAAGCGAGTCGATGACTCGCTGACTCAGTAATTTTAACAGTATAATGATGTGAAGCTGTC
                      ____________________________________________________________
consensus TAAGCGAGTCGATGACTCGCTGACTCAGTAATTTTAACAGTATAATGATGTGAAGCTGTC