Previous Contig 003269:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN007N02Sequence301003269 (4)gb:AJ632084_18127977e-21Catharanthus roseus mRNA for zinc finger DNA-binding protein (zct3 gene).
JMFN046E02Sequence290003269 (4)gb:AJ632084_18127977e-21Catharanthus roseus mRNA for zinc finger DNA-binding protein (zct3 gene).
JMFN046I05Sequence302003269 (4)gb:AJ632084_18127977e-21Catharanthus roseus mRNA for zinc finger DNA-binding protein (zct3 gene).
JMFS048A02Sequence306003269 (4)gb:AJ632084_18127977e-21Catharanthus roseus mRNA for zinc finger DNA-binding protein (zct3 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN046E02+ CGGA
JMFN007N02+ GCCGGA
JMFN046I05+ CGGA
JMFS048A02+ CGGA
                      ____________________________________________________________
consensus GCCGGA
 
. : . : . : . : . : . :
JMFN046E02+ GCCTCCACCGCCTTAGCCGACGACCCACCACCGCTGCGCGCGAGCATAATAAGGCAGAGC
JMFN007N02+ GCCTCCACCGCCTTAGCCGACGACCCACCACCGCTGCGCGCGAGCATAATAAGGCAGAGC
JMFN046I05+ GCCTCCACCGCCTTAGCCGACGACCCACCACCGCTGCGCGCGAGCATAATAAGGCAGAGC
JMFS048A02+ GCCTCCACCGCCTTAGCCGACGACCCACCACCGCTGCGCGCGAGCATAATAAGGCAGAGC
                      ____________________________________________________________
consensus GCCTCCACCGCCTTAGCCGACGACCCACCACCGCTGCGCGCGAGCATAATAAGGCAGAGC
 
. : . : . : . : . : . :
JMFN046E02+ GCCAAATACTCCTCCTCAGTAGGCTGACGCTCCACGCTGCGCGGCCGCTTGGATCGCTTC
JMFN007N02+ GCCAAATACTCCTCCTCAGTAGGCTGACGCTCCACGCTGCGCGGCCGCTTGGATCGCTTC
JMFN046I05+ GCCAAATACTCCTCCTCAGTAGGCTGACGCTCCACGCTGCGCGGCCGCTTGGATCGCTTC
JMFS048A02+ GCCAAATACTCCTCCTCAGTAGGCTGACGCTCCACGCTGCGCGGCCGCTTGGATCGCTTC
                      ____________________________________________________________
consensus GCCAAATACTCCTCCTCAGTAGGCTGACGCTCCACGCTGCGCGGCCGCTTGGATCGCTTC
 
. : . : . : . : . : . :
JMFN046E02+ CCCTTCGCCCACTGCTGATCAAGGTAGCTCAGGCTCGCCGGATCCTCGAACTGAAACACC
JMFN007N02+ CCCTTCGCCCACTGCTGATCAAGGTAGCTCAGGCTCGCCGGATCCTCGAACTGAAACACC
JMFN046I05+ CCCTTCGCCCACTGCTGATCAAGGTAGCTCAGGCTCGCCGGATCCTCGAACTGAAACACC
JMFS048A02+ CCCTTCGCCCACTGCTGATCAAGGTAGCTCAGGCTCGCCGGATCCTCGAACTGAAACACC
                      ____________________________________________________________
consensus CCCTTCGCCCACTGCTGATCAAGGTAGCTCAGGCTCGCCGGATCCTCGAACTGAAACACC
 
. : . : . : . : . : . :
JMFN046E02+ GACGCCCGAGGCGTGGTCGGAGAATTCAAAGCTTCAAGAGCCATATCAATCTTTCTTCTT
JMFN007N02+ GACGCCCGAGGCGTGGTCGGAGAATTCAAAGCTTCAAGAGCCATATCAATCTTTCTTCTT
JMFN046I05+ GACGCCCGAGGCGTGGTCGGAGAATTCAAAGCTTCAAGAGCCATATCAATCTTTCTTCTT
JMFS048A02+ GACGCCCGAGGCGTGGTCGGAGAATTCAAAGCTTCAAGAGCCATATCAATCTTTCTTCTT
                      ____________________________________________________________
consensus GACGCCCGAGGCGTGGTCGGAGAATTCAAAGCTTCAAGAGCCATATCAATCTTTCTTCTT
 
. : . : . : . : . : . :
JMFN046E02+ GTTTCAAGAATCAAGAACACTCAGAGAGAAAGAGAGAGAGAGAT
JMFN007N02+ GTTTCAAGAATCAAGAACACTCAGAGAGAAAGAGAGAGAGAGATGTGAAGAGAAA
JMFN046I05+ GTTTCAAGAATCAAGAACACTCAGAGAGAAAGAGAGAGAGAGATGTGAAGAGAAA
JMFS048A02+ GTTTCAAGAATCAAGAACACTCAGAGAGAAAGAGAGAGAGAGATGTGAAGAGAAAGTTGA
                      ____________________________________________________________
consensus GTTTCAAGAATCAAGAACACTCAGAGAGAAAGAGAGAGAGAGATGTGAAGAGAAAGTTGA