Previous Contig 003267:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037J17Sequence562001631 (4)gb:AP003251_18263070.002Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P044733003267 (2)gb:AY096653_15761891e-66Arabidopsis thaliana putative pumilio/Mpt5 family RNA-binding protein (At2g29190
JMFS047H01Sequence245003267 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF037J17+ GCAGTCCGTATGCATGTTGGCACAGGATCAA
                      ____________________________________________________________
consensus GCAGTCCGTATGCATGTTGGCACAGGATCAA
 
. : . : . : . : . : . :
rJMFF037J17+ TATGGAAATTATGTCATTCAGCANGTATTAGAACATGGAAAGCCAGATGAACGGTCGGCT
                      ____________________________________________________________
consensus TATGGAAATTATGTCATTCAGCANGTATTAGAACATGGAAAGCCAGATGAACGGTCGGCT
 
. : . : . : . : . : . :
rJMFF037J17+ ATAATTTGTCAGCTAATAGGACAAATAGTTCATATGAGCCAGCAAAAATTTGCCTCTAAT
                      ____________________________________________________________
consensus ATAATTTGTCAGCTAATAGGACAAATAGTTCATATGAGCCAGCAAAAATTTGCCTCTAAT
 
. : . : . : . : . : . :
rJMFF037J17+ GTTGTGGAGAAGTGCTTAACTTTTGGAACACCCGAAGAGCGTCAAACCTTGGTAAATGAG
                      ____________________________________________________________
consensus GTTGTGGAGAAGTGCTTAACTTTTGGAACACCCGAAGAGCGTCAAACCTTGGTAAATGAG
 
. : . : . : . : . : . :
rJMFF037J17+ ATGCTTGGCTCCAATGACGAGAATGAACCACTTCAGGCGATGATGAAAGATCAATTTGCA
                      ____________________________________________________________
consensus ATGCTTGGCTCCAATGACGAGAATGAACCACTTCAGGCGATGATGAAAGATCAATTTGCA
 
. : . : . : . : . : . :
rJMFF037J17+ AACTATGTCGTACAAAAGGTGCTGGAGACTTGCGATGACCAGCAGCTTGAACTTATCCTC
                      ____________________________________________________________
consensus AACTATGTCGTACAAAAGGTGCTGGAGACTTGCGATGACCAGCAGCTTGAACTTATCCTC
 
. : . : . : . : . : . :
rJMFF037J17+ AACCGAATAAAGGTTCACTTGAATGCTCTGAAGAAATATACCTACGGAAAACATATAGTT
                      ____________________________________________________________
consensus AACCGAATAAAGGTTCACTTGAATGCTCTGAAGAAATATACCTACGGAAAACATATAGTT
 
. : . : . : . : . : . :
rJMFF037J17+ GCCCGGGTCGAGAAACTTGTTGCTGCTGGGGAGAGGAGGATCATGATCCTGTCATTGAAT
                      ____________________________________________________________
consensus GCCCGGGTCGAGAAACTTGTTGCTGCTGGGGAGAGGAGGATCATGATCCTGTCATTGAAT
 
. : . : . : . : . : . :
rJMFF037J17+ TCTGCACAGATGTAGGAAGGGAATTGCAGAACTAACGACAACACCAGTATGCGTTTCTCT
JMFS047H01+ T
                      ____________________________________________________________
consensus TCTGCACAGATGTAGGAAGGGAATTGCAGAACTAACGACAACACCAGTATGCGTTTCTCT
 
. : . : . : . : . : . :
rJMFF037J17+ CTTGTTTCTTCTCGTATCCTGCTTTAGCTCGATCTTAGGCTCTTAGCTGTATCGGTTAAA
JMFS047H01+ CTTGTTTCTTCTCGTATCGTGCTTTAGCTCGATGTTAGGCTCTTAGCTGTATCGGTTAAA
                      ____________________________________________________________
consensus CTTGTTTCTTCTCGTATCGTGCTTTAGCTCGATGTTAGGCTCTTAGCTGTATCGGTTAAA
 
. : . : . : . : . : . :
rJMFF037J17+ TATGGGCGTTTAGCGCCCGTTAGAATAGAACTTGTGAGTTGTACATTGTTAGATTGAGGA
JMFS047H01+ TATGGGCGTTTAGCGCCCGTTAGAATAGAACTTGTGAGTTGTACATTGTTAGATTGAGGA
                      ____________________________________________________________
consensus TATGGGCGTTTAGCGCCCGTTAGAATAGAACTTGTGAGTTGTACATTGTTAGATTGAGGA
 
. : . : . : . : . : . :
rJMFF037J17+ TAGAGTTAGAATGAGATTTAGCCATAGCCCAGATGGTGAACATGCCTGATGCCCCTACAG
JMFS047H01+ TAGAGTTAGAATGAGATTTAGCCATAGCCCAGATGGTGAACATGCCTGATGCCCCTACAG
                      ____________________________________________________________
consensus TAGAGTTAGAATGAGATTTAGCCATAGCCCAGATGGTGAACATGCCTGATGCCCCTACAG
 
. : . : . : . : . : . :
rJMFF037J17+ GAAGGAGATCACAGGTACTGTACAAGTTTTAAGAT
JMFS047H01+ GAAGGAGATCACAGGTGCTGTACAAGTTTTAAGATTGTAAAGAGGAAAGCCNCTGGCTGT
                      ____________________________________________________________
consensus GAAGGAGATCACAGGTGCTGTACAAGTTTTAAGATTGTAAAGAGGAAAGCCNCTGGCTGT