Previous Contig 003263:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002B19Sequence578003263 (4)sp|Q96372|CC48_CAPAN2e-75Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4714002679 (3)sp|Q96372|CC48_CAPAN1e-78Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4
JMFS028D06Sequence625003263 (4)sp|Q96372|CC48_CAPAN6e-88Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4
JMFS047F01Sequence621003263 (4)sp|Q96372|CC48_CAPAN6e-88Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4
JMFS104B12Sequence620003263 (4)sp|Q96372|CC48_CAPAN1e-88Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS028D06+ ATTTCAGTGTCTGGAGCAA
JMFS104B12+ CAGAAGATTTCAGTGTCTGGAGCAA
JMFS047F01+ ATTTCAGTGTCTGGAGCAA
                      ____________________________________________________________
consensus CAGAAGATTTCAGTGTCTGGAGCAA
 
. : . : . : . : . : . :
JMFS028D06+ CAACACAATATTCCCCTGGATCTGTCTCAATGACCTTGAATTCCACACTTCTCATACCCC
JMFF002B19+ TTCCACACTTCTCATACCCC
JMFS104B12+ CAACACAATATTCCCCTGGATCTGTCTCAATGACCTTGAATTCCACACTTCTCATACCCC
JMFS047F01+ CAACACAATATTCCCCTGGATCTGTCTCAATGACCTTGAATTCCACACTTCTCATACCCC
                      ____________________________________________________________
consensus CAACACAATATTCCCCTGGATCTGTCTCAATGACCTTGAATTCCACACTTCTCATACCCC
 
. : . : . : . : . : . :
JMFS028D06+ CTCGAATAAGGAAGTGGTCTCCTTTCCTCAAAGGACGATATGCCTCCAAAAAGTAAGGTT
JMFF002B19+ CTCGAATAAGGAAGTGGTCTCCTTTCCTCAAAGGACGATATGCCTCCAAAAAGTAAGGTT
JMFS104B12+ CTCGAATAAGGAAGTGGTCTCCTTTCCTCAAAGGACGATATGCCTCCAAAAAGTAAGGTT
JMFS047F01+ CTCGAATAAGGAAGTGGTCTCCTTTCCTCAAAGGACGATATGCCTCCAAAAAGTAAGGTT
                      ____________________________________________________________
consensus CTCGAATAAGGAAGTGGTCTCCTTTCCTCAAAGGACGATATGCCTCCAAAAAGTAAGGTT
 
. : . : . : . : . : . :
JMFS028D06+ TCAAGTATGATTCAAAGAGATCACCAGTGACCCCTTCAATTGTATCATCTATAGGAAGTA
JMFF002B19+ TCAAGTATGATTCAAAGAGATCACCAGTGACCCCTTCAATTGTATCATCTATAGGAAGTA
JMFS104B12+ TCAAGTATGATTCAAAGAGATCACCAGTGACCCCTTCAATTGTATCATCTATAGGAAGTA
JMFS047F01+ TCAAGTATGATTCAAAGAGATCACCAGTGACCCCTTCAATTGTATCATCTATAGGAAGTA
                      ____________________________________________________________
consensus TCAAGTATGATTCAAAGAGATCACCAGTGACCCCTTCAATTGTATCATCTATAGGAAGTA
 
. : . : . : . : . : . :
JMFS028D06+ TGTGCACACGTTTCCCATACTTAACATCTGGACATTGATGTACAGATACAACATCAGCAA
JMFF002B19+ TGTGCACACGTTTCCCATACTTAACATCTGGACATTGATGTACAGATACAACATCAGCAA
JMFS104B12+ TGTGCACACGTTTCCCATACTTAACATCTGGACATTGATGTACAGATACAACATCAGCAA
JMFS047F01+ TGTGCACACGTTTCCCATACTTAACATCTGGACATTGATGTACAGATACAACATCAGCAA
                      ____________________________________________________________
consensus TGTGCACACGTTTCCCATACTTAACATCTGGACATTGATGTACAGATACAACATCAGCAA
 
. : . : . : . : . : . :
JMFS028D06+ GTCGGACCCTCAAATTTGACCGGACAACTTTATTCATCCTAATCTTTGCCTCTTCACATG
JMFF002B19+ GTCGGACCCTCAAATTTGACCGGACAACTTTATTCATCCTAATCTTTGCCTCTTCACATG
JMFS104B12+ GTCGGACCCTCAAATTTGACCGGACAACTTTATTCATCCTAATCTTTGCCTCTTCACATG
JMFS047F01+ GTCGGACCCTCAAATTTGACCGGACAACTTTATTCATCCTAATCTTTGCCTCTTCACATG
                      ____________________________________________________________
consensus GTCGGACCCTCAAATTTGACCGGACAACTTTATTCATCCTAATCTTTGCCTCTTCACATG
 
. : . : . : . : . : . :
JMFS028D06+ TCTCATCAGCAAGAGCAATAACCACTGTATCTTTCCTTTTTTTGCCCTTAATCAGAATCG
JMFF002B19+ TCTCATCAGCAAGAGCAATAACCACTGTATCTTTCCTTTTTTTGCCCTTAATCAGAATCG
JMFS104B12+ TCTCATCAGCAAGAGCAATAACCACTGTATCTTTCCTTTTTTTGCCCTTAATCAGAATCG
JMFS047F01+ TCTCATCAGCAAGAGCAATAACCACTGTATCTTTCCTTTTTTTGCCCTTAATCAGAATCG
                      ____________________________________________________________
consensus TCTCATCAGCAAGAGCAATAACCACTGTATCTTTCCTTTTTTTGCCCTTAATCAGAATCG
 
. : . : . : . : . : . :
JMFS028D06+ TGTCTCCACGGAAGAGCTGGAGCTTCTCCATGGTAGCAGGGTGGAGAGCAACGACGGAGT
JMFF002B19+ TGTCTCCACGGAAGAGCTGGAGCTTCTCCATGGTAGCAGGGTGGAGAGCAACGACGGAGT
JMFS104B12+ TGTCTCCACGGAAGAGCTGGAGCTTCTCCATGGTAGCAGGGTGGAGAGCAACGACGGAGT
JMFS047F01+ TGTCTCCACGGAAGAGCTGGAGCTTCTCCATGGTAGCAGGGTGGAGAGCAACGACGGAGT
                      ____________________________________________________________
consensus TGTCTCCACGGAAGAGCTGGAGCTTCTCCATGGTAGCAGGGTGGAGAGCAACGACGGAGT
 
. : . : . : . : . : . :
JMFS028D06+ TATCATCATTGATCGCCTCATCCACGACAAGCCGATTCGGCGCCTTCTTCCGCTCCAGAA
JMFF002B19+ TATCATCATTGATCGCCTCATCCACGACAAGCCGATTCGGCGCCTTCTTCCGCTCCAGAA
JMFS104B12+ TATCATCATTGATCGCCTCATCCACGACAAGCCGATTCGGCGCCTTCTTCCGCTCCAGAA
JMFS047F01+ TATCATCATTGATCGCCTCATCCACGACAAGCCGATTCGGCGCCTTCTTCCGCTCCAGAA
                      ____________________________________________________________
consensus TATCATCATTGATCGCCTCATCCACGACAAGCCGATTCGGCGCCTTCTTCCGCTCCAGAA
 
. : . : . : . : . : . :
JMFS028D06+ TCGCCGTAGAGAAGTCCTTCTTAGTACTTTTCGAGTCAGATGACTCGGCTTGGTGACTCA
JMFF002B19+ TCGCCGTAGAGAAGTCCTTCTTAGTACTTTTCGAGTCAGATGACTCGGCTTGGTGACTCA
JMFS104B12+ TCGCCGTAGAGAAGTCCTTCTTAGTACTTTTCGAGTCAGATGACTCGGCTTGGTGACTCA
JMFS047F01+ TCGCCGTAGAGAAGTCCTTCTTAGTACTTTTCGAGTCAGATGACTCGGCTTGGTGACTCA
                      ____________________________________________________________
consensus TCGCCGTAGAGAAGTCCTTCTTAGTACTTTTCGAGTCAGATGACTCGGCTTGGTGACTCA
 
. : . : . : . : . : . :
JMFS028D06+ TCTTCGATCT
JMFF002B19+ TCTTCGATCT
JMFS104B12+ TCTTCGATCTGAAATTGGATAGCCGAGGACGAGGGAGAGATATTTTGCCGGAGAA
JMFS047F01+ TCTTCGATCTGAAATTGGATAGCCGAGGACGAGGGAGAGATATTTTGCCGGAGAAGGAAA
                      ____________________________________________________________
consensus TCTTCGATCTGAAATTGGATAGCCGAGGACGAGGGAGAGATATTTTGCCGGAGAAGGAAA