Previous Contig 003259:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN032B15Sequence623003259 (7)gb:AF175964_17745261e-94Lycopersicon esculentum JAB mRNA, complete cds.
JMFS047D10Sequence616003259 (7)gb:AF175964_17745266e-81Lycopersicon esculentum JAB mRNA, complete cds.
JMFS114C10Sequence553003259 (7)gb:AF175964_17745262e-78Lycopersicon esculentum JAB mRNA, complete cds.
JMSF005H05Sequence356003259 (7)gb:AF175964_17745262e-31Lycopersicon esculentum JAB mRNA, complete cds.519003259 (7)pir|T09261|T092612e-59JUN kinase-activation-domain-binding protein homolog - alfalfa>gb:AF014375_17613
JMSF014H08Sequence271003259 (7)gb:AF175964_17745264e-20Lycopersicon esculentum JAB mRNA, complete cds.770003259 (7)pir|T09261|T09261e-109JUN kinase-activation-domain-binding protein homolog - alfalfa>gb:AF014375_17613

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF005H05- TCAATTCGTATATCAGCCAC
rJMSF014H08- TCAATTCGTATATCAGCCAC
                      ____________________________________________________________
consensus TCAATTCGTATATCAGCCAC
 
. : . : . : . : . : . :
rJMSF005H05- AGCCAACAATCCCACAACTTCCAATTAACAAAAAAAGAGATCTACATGAGATGAGGATAA
rJMSF014H08- AGCCAACAATCCCACAACTTCCAATTAACAAAAAAAGAGATCTACATGAGATGAGGATAA
                      ____________________________________________________________
consensus AGCCAACAATCCCACAACTTCCAATTAACAAAAAAAGAGATCTACATGAGATGAGGATAA
 
. : . : . : . : . : . :
rJMSF005H05- CAACTAATGTAATATTGAGTTCATGTTTCAACCATGGGCTCAGGTCCTGAGGACTCTGTC
rJMSF014H08- CAACTAATGTAATATTGAGTTCATGTTTCAACCATGGGCTCAGGTCCTGAGGACTCTGTC
                      ____________________________________________________________
consensus CAACTAATGTAATATTGAGTTCATGTTTCAACCATGGGCTCAGGTCCTGAGGACTCTGTC
 
. : . : . : . : . : . :
rJMSF005H05- CGGGATCTGTTTGACTGACGAACTGTGTTGAAAAGGATGTCCTTGATAACCTGTGACATT
rJMSF014H08- CGGGATCTGTTTGACTGACGAACTGTGTTGAAAAGGATGTCCTTGATAACCTGTGACATT
                      ____________________________________________________________
consensus CGGGATCTGTTTGACTGACGAACTGTGTTGAAAAGGATGTCCTTGATAACCTGTGACATT
 
. : . : . : . : . : . :
rJMSF005H05- AGTCCATGAACCTGCTCCACAGTTATCTTTGCACTATCACAAGTTATCTTAGCAAGTTGA
rJMSF014H08- AGTCCATGAACCTGCTCCACAGTTATCTTTGCACTATCACAAGTTATCTTAGCAAGTTGA
                      ____________________________________________________________
consensus AGTCCATGAACCTGCTCCACAGTTATCTTTGCACTATCACAAGTTATCTTAGCAAGTTGA
 
. : . : . : . : . : . :
rJMSF005H05- GATTCCTCCTCTTTCTTCCTCTGAGCAGGAGCTATCAAGGGTCCAAACCTTGAATGAGAT
rJMSF014H08- GATTCCTCCTCTTTCTTCCTCTGAGCAGGAGCTATCAAGGGTCCAAACCTTGAATGAGAT
                      ____________________________________________________________
consensus GATTCCTCCTCTTTCTTCCTCTGAGCAGGAGCTATCAAGGGTCCAAACCTTGAATGAGAT
 
. : . : . : . : . : . :
rJMSF005H05- AGTTGGTTCTCAGCTTGTTCTAGCTTTTCAGCAAGATCTGAAATCTGTCCTGCAACATAG
rJMSF014H08- AGTTGGTTCTCAGCTTGTTCTAGCTTTTCAGCAAGATCTGAAATCTGTCCTGCAACATAG
                      ____________________________________________________________
consensus AGTTGGTTCTCAGCTTGTTCTAGCTTTTCAGCAAGATCTGAAATCTGTCCTGCAACATAG
 
. : . : . : . : . : . :
rJMSF005H05- TCTCCATTCCCAAGTAAAGGAGAAGAAGAAAGTGTGTTCACCCAATACTTATTCCATAAA
rJMSF014H08- TCTCCATTCCCAAGTAAAGGAGAAGAAGAAAGTGTGTTCACCCAATACTTATTCCATAAA
                      ____________________________________________________________
consensus TCTCCATTCCCAAGTAAAGGAGAAGAAGAAAGTGTGTTCACCCAATACTTATTCCATAAA
 
. : . : . : . : . : . :
rJMSF005H05- AGATCCAAAAGATGAGAGTCCAGAGATGATTTGAAATATGTGATGTCCAAAGAATAATAC
rJMSF014H08- AGATCCAAAAGATGAGAGTCCAGAGATGATTTGAAATATGTGATGTCCAAAGAATAATAC
                      ____________________________________________________________
consensus AGATCCAAAAGATGAGAGTCCAGAGATGATTTGAAATATGTGATGTCCAAAGAATAATAC
 
. : . : . : . : . : . :
rJMSF005H05- TGTTTGCAGTGCACTCCAA
rJMSF014H08- TGTTTGCAGTGCACTCCAAAATCTTCAATTTTGTTCAAAGGGATGGTCTGATACTCAGAG
                      ____________________________________________________________
consensus TGTTTGCAGTGCACTCCAAAATCTTCAATTTTGTTCAAAGGGATGGTCTGATACTCAGAG
 
. : . : . : . : . : . :
rJMSF014H08- ACTGGTTCATCTGGCGGCTTATATCCCTCTGGGTATGTTCTGAACGCACCAATCTCAACT
JMFN032B15+ GGTATGTTCTGAACGCACCAATCTCAACT
                      ____________________________________________________________
consensus ACTGGTTCATCTGGCGGCTTATATCCCTCTGGGTATGTTCTGAACGCACCAATCTCAACT
 
. : . : . : . : . : . :
rJMSF014H08- TTCCCAGCAGAAACAGTTCTTGTTGGATCAATAACTACGGCTAGAAAGGGCTCCTGAAAT
JMFN032B15+ TTCCCAGCAGAAACAGTTCTTGTTGGATCAATAACTACGGCTAGAAAGGGCTCCTGAAAT
JMFS047D10+ AAAGGGCTCCTGAAAT
                      ____________________________________________________________
consensus TTCCCAGCAGAAACAGTTCTTGTTGGATCAATAACTACGGCTAGAAAGGGCTCCTGAAAT
 
. : . : . : . : . : . :
rJMSF014H08- TGCTGGTTTAGCATTTGTGTAGAACCATCAATACCAGAAAGCCAGCATCCATAGCCAGGA
JMFN032B15+ TGCTGGTTTAGCATTTGTGTAGAAACATCAATACCAGAAAGCCAGCATCCATAGCCAGGA
JMFS114C10+ TGCTGGTTTAGCATTTGTGTAGAAACATCAATACCAGAAAGCCAGCATCCATAGCCAGGA
JMFS047D10+ TGCTGGTTTAGCATTTGTGTAGAAACATCAATACCAGAAAGCCAGCATCCATAGCCAGGA
                      ____________________________________________________________
consensus TGCTGGTTTAGCATTTGTGTAGAAACATCAATACCAGAAAGCCAGCATCCATAGCCAGGA
 
. : . : . : . : . : . :
rJMSF014H08- TGGGAATGATACCATCCANCAACATTCTCC
JMFN032B15+ TGGGAATGATACCATCCAACAACATTCTCCAACCGACCAGCCTGTTTATTTGTTTGCGAA
JMFS114C10+ TGGGAATGATACCATCCAACAACATTCTCCAACCGACCAGCCTGTTTATTTGTTTGCGAA
JMFS047D10+ TGGGAATGATACCATCCAACAACATTCTCCAACCGACCAGCCTGTTTATTTGTTTGCGAA
                      ____________________________________________________________
consensus TGGGAATGATACCATCCAACAACATTCTCCAACCGACCAGCCTGTTTATTTGTTTGCGAA
 
. : . : . : . : . : . :
JMFN032B15+ TAATCGACCATGTACTCATAAGCATCGGCCTGAGCATTAACCCTAGTCTCAGTGCCTTCG
JMFS114C10+ TAATCGACCATGTACTCATAAGCATCGGCCTGAGCATTAACCCTAGTCTCAGTGCCTTCG
JMFS047D10+ TAATCGACCATGTACTCATAAGCATCGGCCTGAGCATTAACCCTAGTCTCAGTGCCTTCG
                      ____________________________________________________________
consensus TAATCGACCATGTACTCATAAGCATCGGCCTGAGCATTAACCCTAGTCTCAGTGCCTTCG
 
. : . : . : . : . : . :
JMFN032B15+ ACGGGAAGAGCGAAGGCATCCATGACAATGATGGCGTCGCCGTCGGTTTTCCCCTGCATA
JMFS114C10+ ACGGGAAGAGCGAAGGCATCCATGACAATGATGGCGTCGCCGTCGGTTTTCCCCTGCATA
JMSF005H05+ CCTGCATA
JMFS047D10+ ACGGGAAGAGCGAAGGCATCCATGACAATGATGGCGTCGCCGTCGGTTTTCCCCTGCATA
                      ____________________________________________________________
consensus ACGGGAAGAGCGAAGGCATCCATGACAATGATGGCGTCGCCGTCGGTTTTCCCCTGCATA
 
. : . : . : . : . : . :
JMFN032B15+ AGGCCCATAACCTCGATGGTGCCACCGGAGCGCGCATGGACAACCATCTTGAGAAGCGCG
JMFS114C10+ AGGCCCATAACCTCGATGGTGCCACCGGAGCGCGCATGGACAACCATCTTGAGAAGCGCG
JMSF014H08+ AAGCGCG
JMSF005H05+ AGGCCCATAACCTCGATGGTGCCACCGGAGCGCGCATGGACAACCATCTTGAGAAGCGCG
JMFS047D10+ AGGCCCATAACCTCGATGGTGCCACCGGAGCGCGCATGGACAACCATCTTGAGAAGCGCG
                      ____________________________________________________________
consensus AGGCCCATAACCTCGATGGTGCCACCGGAGCGCGCATGGACAACCATCTTGAGAAGCGCG
 
. : . : . : . : . : . :
JMFN032B15+ AGTGCGGAGATCTTGACGCGCTTGAAGTAGTGCGGATCGTTGGTCCATGGCTTCTCCTGC
JMFS114C10+ AGTGCGGAGATCTTGACGCGCTTGAAGTAGTGCGGATCGTTGGTCCATGGCTTCTCCTGC
JMSF014H08+ AGTGCGGAGATCTTGACGCGCTTGAAGTAGTGCGGATCGTTGGTCCATGGCTTCTCCTGC
JMSF005H05+ AGTGCGGAGATCTTGACGCGCTTGAAGTAGTGCGGATCGTTGGTCCATGGCTTCTCCTGC
JMFS047D10+ AGTGCGGAGATCTTGACGCGCTTGAAGTAGTGCGGATCGTTGGTCCATGGCTTCTCCTGC
                      ____________________________________________________________
consensus AGTGCGGAGATCTTGACGCGCTTGAAGTAGTGCGGATCGTTGGTCCATGGCTTCTCCTGC
 
. : . : . : . : . : . :
JMFN032B15+ TGGAACTTGGTCTGCGCCGTCTCATCGTAGTAAAATATGGCGTCCGACGATGCCGAGGCG
JMFS114C10+ TGGAACTTGGTCTGCGCCGTCTCATCGTAGTAAAATATGGCGTCCGACGATGCCGAGGCG
JMSF014H08+ TGGAACTTGGTCTGCGCCGTCTCATCGTAGTAAAATATGGCGTCCGACGATGCCGAGGCG
JMSF005H05+ TGGAACTTGGTCTGCGCCGTCTCATCGTAGTAAAATATGGCGTCCGACGATGCCGAGGCG
JMFS047D10+ TGGAACTTGGTCTGCGCCGTCTCATCGTAGTAAAATATGGCGTCCGACGATGCCGAGGCG
                      ____________________________________________________________
consensus TGGAACTTGGTCTGCGCCGTCTCATCGTAGTAAAATATGGCGTCCGACGATGCCGAGGCG
 
. : . : . : . : . : . :
JMFN032B15+ GCGGCGGAGTCGGCCGACGTCGGCGGCAAGTCCATTGTCTCAACGTTGTTCTCTATCTCC
JMFS114C10+ GCGGCGGAGTCGGCCGACGTCGGCGGCAAGTCCATTGTCTCAACGTTGTTCTCTATCTCC
JMSF014H08+ GCGGCGGAGTCGGCCGACGTCGGCGGCAAGTCCATTGTCTCAACGTTGTTCTCTATCTCC
JMSF005H05+ GCGGCGGAGTCGGCCGACGTCGGCGGCAAGTCCATTGTCTCAACGTTGTTCTCTATCTCC
JMFS047D10+ GCGGCGGAGTCGGCCGACGTCGGCGGCAAGTACATTGTCTCAACGTTGTTCTCTATCTCC
                      ____________________________________________________________
consensus GCGGCGGAGTCGGCCGACGTCGGCGGCAAGTCCATTGTCTCAACGTTGTTCTCTATCTCC
 
. : . : . : . : . : . :
JMFN032B15+ CAGGTCTTCTGGGCAATTGCCGCCGATGATG-GAAAGAATCCATTAGG
JMFS114C10+ CAGGTCTTCTGGGCAATTGCCGCCGATGATGTGAAAGAATCCATTAGGTGTAAAGCTCTT
JMSF014H08+ CAGGTCTTCTGGGCAATTGCCGCCGATGATGTGAAAGAATCCATTAGGTGTAAAGCTCTT
JMSF005H05+ CAGGTCTTCTGGGCAATTGCCGCCGATGATGTGAAAGAATCCATTAGGTGTAAAGCTCTT
JMFS047D10+ CAGGTCTTCTGGGCAATTGCCGCCGATGATGTGAAAGAATCCATTAGGTGTAAAGCTCTT
                      ____________________________________________________________
consensus CAGGTCTTCTGGGCAATTGCCGCCGATGATGTGAAAGAATCCATTAGGTGTAAAGCTCTT
 
. : . : . : . : . : . :
JMFS114C10+ GGAGAGGACACGC
JMSF014H08+ GGAGAGGACACGCCACTATAACT
JMSF005H05+ GGAGAGGACACGCCACTATAACTGAGCTCTTGTGCAGTGCCGCCTGT
JMFS047D10+ GGAGAGGACACGCCACTATAACTGAGCTCTTGTGCAGTGCCGCCTGTAAATACATATATA
                      ____________________________________________________________
consensus GGAGAGGACACGCCACTATAACTGAGCTCTTGTGCAGTGCCGCCTGTAAATACATATATA