Previous Contig 003258:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS047D09Sequence622003258 (2)pir|T05566|T055663e-22hypothetical protein F22K18.120 - Arabidopsis thaliana>gb:ATCHRIV62_1546351 Arab
JMFS164E06Sequence603003258 (2)pir|T05566|T055663e-24hypothetical protein F22K18.120 - Arabidopsis thaliana>gb:ATCHRIV62_1546351 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS164E06+ ATTGGAACCCCATGCACTCACACTGGGTTCATGTGTTCTATCACT
JMFS047D09+ TGGGTTCATGTGTTCTATCACT
                      ____________________________________________________________
consensus ATTGGAACCCCATGCACTCACACTGGGTTCATGTGTTCTATCACT
 
. : . : . : . : . : . :
JMFS164E06+ ACCAGCAGTAGATGGTCGACTACCGTTCCCACCAGAAGAAGGGCAGGCACTGAGATGACT
JMFS047D09+ ACCAGCAGTAGATGGTCGACTACCGTTCCCACCAGAAGAAGGGCAGGCACTGAGATGACT
                      ____________________________________________________________
consensus ACCAGCAGTAGATGGTCGACTACCGTTCCCACCAGAAGAAGGGCAGGCACTGAGATGACT
 
. : . : . : . : . : . :
JMFS164E06+ CGGAGAGCTATTGCCACCATCAGCATTTGGGGACAATGTAGAAGAAGCCCATGCATTTGG
JMFS047D09+ CGGAGAGCTATTGCCACCATCAGCATTTGGGGACAATGTAGAAGAAGCCCATGCATTTGG
                      ____________________________________________________________
consensus CGGAGAGCTATTGCCACCATCAGCATTTGGGGACAATGTAGAAGAAGCCCATGCATTTGG
 
. : . : . : . : . : . :
JMFS164E06+ GGTAGTTGAAGATGTTTTGCTTCCCCAGCTGAGAGTTCCCTTGGGAACAATTTCAACATC
JMFS047D09+ GGTAGTTGAAGATGTTTTGCTTCCCCAGCTGAGAGTTCCCTTGGGAACAATTTCAACATC
                      ____________________________________________________________
consensus GGTAGTTGAAGATGTTTTGCTTCCCCAGCTGAGAGTTCCCTTGGGAACAATTTCAACATC
 
. : . : . : . : . : . :
JMFS164E06+ TGGATCCAATCCGTGGTTCTCTAATCTCTGACTTGGTAAATTCAAGGGTTTTGGAACAGC
JMFS047D09+ TGGATCCAATCCGTGGTTCTCTAATCTCTGACTTGGTAAATTCAAGGGTTTTGGAACAGC
                      ____________________________________________________________
consensus TGGATCCAATCCGTGGTTCTCTAATCTCTGACTTGGTAAATTCAAGGGTTTTGGAACAGC
 
. : . : . : . : . : . :
JMFS164E06+ AACTTTGCCAAGGACAGTCATGCCACCTCTCCTTGCAGACGCCCACCTTCGCTCCCCAGT
JMFS047D09+ AACTTTGCCAAGGACAGTCATGCCACCTCTCCTTGCAGACGCCCACCTTCGCTCCCCAGT
                      ____________________________________________________________
consensus AACTTTGCCAAGGACAGTCATGCCACCTCTCCTTGCAGACGCCCACCTTCGCTCCCCAGT
 
. : . : . : . : . : . :
JMFS164E06+ TAACATACTTGAAGTCATTGCTAATATATAGATCTAATGTCATCCAAACTACAACCTTAA
JMFS047D09+ TAACATACTTGAAGTCATTGCTAATATATAGATCTAATGTCATCCAAACTACAACCTTAA
                      ____________________________________________________________
consensus TAACATACTTGAAGTCATTGCTAATATATAGATCTAATGTCATCCAAACTACAACCTTAA
 
. : . : . : . : . : . :
JMFS164E06+ ATCCACGGAGAGAAGAGGGAAATTAACCGGATCTGCGAAAGCTCCGATCTGTGAGTTGTT
JMFS047D09+ ATCCACGGAGAGAAGAGGGAAATTAACCGGATCTGCGAAAGCTCCGATCTGTGAGTTGTT
                      ____________________________________________________________
consensus ATCCACGGAGAGAAGAGGGAAATTAACCGGATCTGCGAAAGCTCCGATCTGTGAGTTGTT
 
. : . : . : . : . : . :
JMFS164E06+ CGAAAAGGACAACAAAGTAACAAACACGTATGCATATAAATTATATCTATATATATAAAT
JMFS047D09+ CGAAAAGGACAACAAAGTAACAAACACGTATGCATATAAATTATATCTATATATATAAAT
                      ____________________________________________________________
consensus CGAAAAGGACAACAAAGTAACAAACACGTATGCATATAAATTATATCTATATATATAAAT
 
. : . : . : . : . : . :
JMFS164E06+ ATATACGTATATATGGGAGGGAGAGAGAAAGAGAGAGGGAAGGAGAGGATATGGTGCGTA
JMFS047D09+ ATATACGTATATATGGGAGGGAGAGAGAAAGAGAGAGGGAAGGAGAGGATATGGTGCGTA
                      ____________________________________________________________
consensus ATATACGTATATATGGGAGGGAGAGAGAAAGAGAGAGGGAAGGAGAGGATATGGTGCGTA
 
. : . : . : . : . : . :
JMFS164E06+ TATATGTATCGGTTTGTA
JMFS047D09+ TATATGTATCGGTTTGTATAGAGGAATGGCGCAGGAGGACGGAGTGAGGAAGAGAGAGGG
                      ____________________________________________________________
consensus TATATGTATCGGTTTGTATAGAGGAATGGCGCAGGAGGACGGAGTGAGGAAGAGAGAGGG