Previous Contig 003249:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS036A11Sequence447003249 (3)
JMFS046H12Sequence622003249 (3)gb:AE016751_3238993e-04Staphylococcus epidermidis ATCC 12228, section 8 of 9 of the complete genome.>gb
JMFS132C06Sequence622003249 (3)gb:AY056321_15636321e-07Arabidopsis thaliana unknown protein (At1g04080) mRNA, complete cds.>gb:AY087878

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS132C06+ ATAAGAGCAGTCCATGCACCANAGTCTAGA
                      ____________________________________________________________
consensus ATAAGAGCAGTCCATGCACCANAGTCTAGA
 
. : . : . : . : . : . :
JMFS132C06+ GAATTTGTTCTCACTATGCTCCATAGTCGTTCTTCTTCAGCAGATAAAGCAGATCCATCC
JMFS046H12+ AGCAGATAAAGCAGATCCATCC
                      ____________________________________________________________
consensus GAATTTGTTCTCACTATGCTCCATAGTCGTTCTTCTTCAGCAGATAAAGCAGATCCATCC
 
. : . : . : . : . : . :
JMFS132C06+ ACTGGCTGGTGCATTGCGGCAGAATCATGAATATTGTCTGATGGAATTCCATTTTCTGTA
JMFS046H12+ ACTGGCTGGTGCATTGCGGCAGAATCATGAATATTGTCTGATGGAATTCCATTTTCTGTA
                      ____________________________________________________________
consensus ACTGGCTGGTGCATTGCGGCAGAATCATGAATATTGTCTGATGGAATTCCATTTTCTGTA
 
. : . : . : . : . : . :
JMFS132C06+ ATACCAGTGGATGCTACATCTCTTGCTTCATTATTAGTGCCATTTATAGAAGTGGCATAT
JMFS046H12+ ATACCAGTGGATGCTACATCTCTTGCTTCATTATTAGTGCCATTTATAGAAGTGGCATAT
                      ____________________________________________________________
consensus ATACCAGTGGATGCTACATCTCTTGCTTCATTATTAGTGCCATTTATAGAAGTGGCATAT
 
. : . : . : . : . : . :
JMFS132C06+ GATGCAACTTGAGATGCATCCAAATGTCCACCAACATTTTCATTGGTATCATAGGTCACA
JMFS036A11+ TGCAACTTGAGATGCATCCAAATGTCCACCAACATTTTCATTGGTATCATAGGTCACA
JMFS046H12+ GATGCAACTTGAGATGCATCCAAATGTCCACCAACATTTTCATTGGTATCATAGGTCACA
                      ____________________________________________________________
consensus GATGCAACTTGAGATGCATCCAAATGTCCACCAACATTTTCATTGGTATCATAGGTCACA
 
. : . : . : . : . : . :
JMFS132C06+ ACCGTAGGGGTATCCTGCTGAGCCAAATCTGTAATGCTATCTGCAGCAACAGTAGAACTG
JMFS036A11+ ACCGTAGGGGTATCCTGCTGAGCCAAATCTGTAATGCTATCTGCAGCAACAGTAGAACTG
JMFS046H12+ ACCGTAGGGGTATCCTGCTGAGCCAAATCTGTAATGCTATCTGCAGCAACAGTAGAACTG
                      ____________________________________________________________
consensus ACCGTAGGGGTATCCTGCTGAGCCAAATCTGTAATGCTATCTGCAGCAACAGTAGAACTG
 
. : . : . : . : . : . :
JMFS132C06+ CGAGTTGAGTCCATAATGGAGGTGGATGTAACAGGATCTCCAATACCAGTATGAGTCCCT
JMFS036A11+ CGAGTTGAGTCCATAATGGAGGTGGATGTAACAGGATCTCCAATACCAGTATGAGTCCCT
JMFS046H12+ CGAGTTGAGTCCATAATGGAGGTGGATGTAACAGGATCTCCAATACCAGTATGAGTCCCT
                      ____________________________________________________________
consensus CGAGTTGAGTCCATAATGGAGGTGGATGTAACAGGATCTCCAATACCAGTATGAGTCCCT
 
. : . : . : . : . : . :
JMFS132C06+ AAATGTTCAGTAGATATAGAGGTATCAGGAGCCACAGGATTGCCAGTGTTCTCCAAATCA
JMFS036A11+ AAATGTTCAGTAGATATAGAGGTATCAGGAGCCACAGGATTGCCAGTGTTCTCCAAATCA
JMFS046H12+ AAATGTTCAGTAGATATAGAGGTATCAGGAGCCACAGGATTGCCAGTGTTCTCCAAATCA
                      ____________________________________________________________
consensus AAATGTTCAGTAGATATAGAGGTATCAGGAGCCACAGGATTGCCAGTGTTCTCCAAATCA
 
. : . : . : . : . : . :
JMFS132C06+ GACGCATTTGAACCTGCATTATTATGATCAGCTGATACATAGTCCATCACAGCAGATGAT
JMFS036A11+ GACGCATTTGAACCTGCATTATTATGATCAGCTGATACATAGTCCATCACAGCAGATGAT
JMFS046H12+ GACGCATTTGAACCTGCATTATTATGATCAGCTGATACATAGTCCATCACAGCAGATGAT
                      ____________________________________________________________
consensus GACGCATTTGAACCTGCATTATTATGATCAGCTGATACATAGTCCATCACAGCAGATGAT
 
. : . : . : . : . : . :
JMFS132C06+ TGAGTCACCACAGTGCCATGGTCAGCCATTGCTAAGAGAAGACCTGGAACCGAGAGATAC
JMFS036A11+ TGAGTCACCACAGTGCCATGGTCAGCCATTGCTAAGAGAAGACCTGGAACCGAGAGATAC
JMFS046H12+ TGAGTCACCACAGTGCCATGGTCAGCCATTGCTAAGAGAAGACCTGGAACCGAGAGATAC
                      ____________________________________________________________
consensus TGAGTCACCACAGTGCCATGGTCAGCCATTGCTAAGAGAAGACCTGGAACCGAGAGATAC
 
. : . : . : . : . : . :
JMFS132C06+ GGCGGCGACGAGCGGTTGAAGGAGAGCTTCCGGCAGTGTGTAGCGGATGCAG
JMFS036A11+ GGCGGCGACGAGCGGTTGAAGGAGAGCTTCCGGCAGTGTGTAGCGGATGCAGGAATGTGT
JMFS046H12+ GGCGGCGACGAGCGGTTGAAGGAGAGCTTCCGGCAGTGTGTAGCGGATGCAGGAATGTGT
                      ____________________________________________________________
consensus GGCGGCGACGAGCGGTTGAAGGAGAGCTTCCGGCAGTGTGTAGCGGATGCAGGAATGTGT
 
. : . : . : . : . : . :
JMFS036A11+ ATTGGTTTGCCTTTTGAGGTTTATTGAGT
JMFS046H12+ ATTGGTTTGCCTTTTGAGGTTTATTGAGTTTCGAGGGTTTTCGATTTGTGGAGGATAGAT
                      ____________________________________________________________
consensus ATTGGTTTGCCTTTTGAGGTTTATTGAGTTTCGAGGGTTTTCGATTTGTGGAGGATAGAT