Previous Contig 003248:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029G21Sequence456003248 (11)pir|B47493|B474932e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s430003248 (11)pir|B47493|B474932e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s
JMFF049K14Sequence471003248 (11)pir|B47493|B474932e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s471003248 (11)pir|B47493|B474932e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s
JMFF050N11Sequence475003248 (11)pir|B47493|B474932e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s475003248 (11)pir|B47493|B474932e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s
JMFN004O19Sequence458003248 (11)pir|B47493|B474932e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s
JMFN011A07Sequence456003248 (11)pir|B47493|B474932e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s
JMFN012I21Sequence460003248 (11)pir|B47493|B474932e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s
JMFS046H03Sequence482003248 (11)pir|B47493|B474932e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s
JMSF044K12Sequence508020260pir|B47493|B474933e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s461003248 (11)pir|B47493|B474932e-34H+-transporting two-sector ATPase (EC 3.6.3.14) epsilon chain, mitochondrial - s

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN004O19+ ACCCCTTTTGA
JMFN012I21+ ACCCCTTTTGA
rJMFF049K14- GA
JMFN011A07+ A
JMFF049K14+ GA
rJMFF050N11- GA
JMFF050N11+ GA
JMFS046H03+ GA
                      ____________________________________________________________
consensus ACCCCTTTTGA
 
. : . : . : . : . : . :
JMFN004O19+ AATTGCATCATTTAATAACCAGAAAGCAATATCCGACAACAAAATGTGGTGGGGAGGAAT
JMFN012I21+ AATTGCATCATTTAATAACCAGAAAGCAATATCCGACAACAAAATGTGGTGGGGAGGAAT
rJMFF049K14- AATTGCATCATTTAATAACCAGAAAGCAATATCCGACAACAAAATGTGGTGGGGAGGAAT
JMFN011A07+ AATTGCATCATTTAATAACCAGAAAGCAATATCCGACAACAAAATGTGGTGGGGAGGAAT
JMFF049K14+ AATTGCATCATTTAATAACCAGAAAGCAATATCCGACAACAAAATGTGGTGGGGAGGAAT
rJMFF029G21- AAATGTGGTGGGGAGGAAT
JMFF029G21+ TAACCAGAAAGCAATATCCGACAACAAAATGTGGTGGGGAGGAAT
rJMFF050N11- AATTGCATCATTTAATAACCAGAAAGCAATATCCGACAACAAAATGTGGTGGGGAGGAAT
JMFF050N11+ AATTGCATCATTTAATAACCAGAAAGCAATATCCGACAACAAAATGTGGTGGGGAGGAAT
rJMSF044K12- ACCAGAAAGCAATATCCGACAACAAAATGTGGTGGGGAGGAAT
JMFS046H03+ AATTGCATCATTTAATAACCAGAAAGCAATATCCGACAACAAAATGTGGTGGGGAGGAAT
                      ____________________________________________________________
consensus AATTGCATCATTTAATAACCAGAAAGCAATATCCGACAACAAAATGTGGTGGGGAGGAAT
 
. : . : . : . : . : . :
JMFN004O19+ GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
JMFN012I21+ GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
rJMFF049K14- GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
JMFN011A07+ GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
JMFF049K14+ GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
rJMFF029G21- GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
JMFF029G21+ GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
rJMFF050N11- GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
JMFF050N11+ GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
rJMSF044K12- GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
JMFS046H03+ GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
                      ____________________________________________________________
consensus GTTACATTTGTGTCTCTGAGCAGAATATCAAAGTTCTGCTGCTTCTGCAGCTCTAATTAT
 
. : . : . : . : . : . :
JMFN004O19+ TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
JMFN012I21+ TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
rJMFF049K14- TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
JMFN011A07+ TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
JMFF049K14+ TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
rJMFF029G21- TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
JMFF029G21+ TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
rJMFF050N11- TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
JMFF050N11+ TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
rJMSF044K12- TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
JMFS046H03+ TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
                      ____________________________________________________________
consensus TACTGAAAATATGTGATGCACTACATATGGTATAAGGTGCCAGGGCAGTGCAAAGTTGAA
 
. : . : . : . : . : . :
JMFN004O19+ CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
JMFN012I21+ CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
rJMFF049K14- CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
JMFN011A07+ CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
JMFF049K14+ CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
rJMFF029G21- CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
JMFF029G21+ CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
rJMFF050N11- CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
JMFF050N11+ CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
rJMSF044K12- CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
JMFS046H03+ CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
                      ____________________________________________________________
consensus CAATCAAAAGCAGTTATTCGGCAAACACAACCTGAGAACACCCTCATTCTTCACCTGTAT
 
. : . : . : . : . : . :
JMFN004O19+ CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
JMFN012I21+ CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
rJMFF049K14- CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
JMFN011A07+ CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
JMFF049K14+ CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
rJMFF029G21- CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
JMFF029G21+ CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
rJMFF050N11- CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
JMFF050N11+ CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
rJMSF044K12- CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
JMFS046H03+ CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
                      ____________________________________________________________
consensus CTGAACGGATGGCGGGTTTCTGGGGCTTGCCATCCACCCATTTGGAGAAGGAGAAGTGGA
 
. : . : . : . : . : . :
JMFN004O19+ CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
JMFN012I21+ CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
rJMFF049K14- CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
JMFN011A07+ CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
JMFF049K14+ CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
rJMFF029G21- CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
JMFF029G21+ CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
rJMFF050N11- CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
JMFF050N11+ CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
rJMSF044K12- CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
JMFS046H03+ CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
                      ____________________________________________________________
consensus CCTTCTCGCGGCTCAGTGCTTCGGATCTGTGGGGCTCCTTGAGGCAGTTCCTCACCATGT
 
. : . : . : . : . : . :
JMFN004O19+ TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
JMFN012I21+ TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
rJMFF049K14- TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
JMFN011A07+ TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
JMFF049K14+ TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
rJMFF029G21- TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
JMFF029G21+ TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
rJMFF050N11- TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
JMFF050N11+ TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
rJMSF044K12- TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
JMFS046H03+ TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
                      ____________________________________________________________
consensus TGGCGCACAGGTTGGAGTATGTGATGTAAGTCATTCCCGCTGCTCTCCAGAACGGCACCG
 
. : . : . : . : . : . :
JMFN004O19+ CTGCGTTCGACGCCATTTTTGTTCTTC
JMFN012I21+ CTGCGTTCGACGCCATTTTTGTTCTTCTC
rJMFF049K14- CTGCGTTCGACGCCATTTTTGTTCTTCTCGCTAACGTCCAATCTCTTCT
JMFN011A07+ CTGCGTTCGACGCCATTTTTGTTCTTCTCGCTAAC
JMFF049K14+ CTGCGTTCGACGCCATTTTTGTTCTTCTCGCTAACGTCCAATCTCTTCT
rJMFF029G21- CTGCGTTCGACGCCATTTTTGTTCTTCTCGCTAACGTCCAATCTCTTCTGC
JMFF029G21+ CTGCGTTCGACGCCATTTTTGTTCTTCTCGCTAACGTCCAATCTCTTCTGC
rJMFF050N11- CTGCGTTCGACGCCATTTTTGTTCTTCTCGCTAACGTCCAATCTCTTCTGC
JMFF050N11+ CTGCGTTCGACGCCATTTTTGTTCTTCTCGCTAACGTCCAATCTCTTCTGC
rJMSF044K12- CTGCGTTCGACGCCATTTTTGTTCTTCTCGCTAACGTCCAATCTCTTCTGC
JMFS046H03+ CTGCGTTCGACGCCATTTTTGTTCTTCTCGCTAACGTCCAATCTCTTCTGCGGTTTCACC
                      ____________________________________________________________
consensus CTGCGTTCGACGCCATTTTTGTTCTTCTCGCTAACGTCCAATCTCTTCTGCGGTTTCACC