Previous Contig 003232:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS044G05Sequence439003232 (6)gb:AC012329_15375742e-26Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence.
JMSF020H11Sequence706003891 (6)gb:AC012329_15375743e-36Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence.787003232 (6)gb:AC012329_15375741e-36Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence.
JMSF030O15Sequence651003891 (6)gb:AY039569_15602825e-41Arabidopsis thaliana AT3g49400/F2K15_260 mRNA, partial cds.768003232 (6)gb:AP003245_18261443e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P042
JMSF031O03Sequence607003891 (6)gb:AY039569_15602823e-39Arabidopsis thaliana AT3g49400/F2K15_260 mRNA, partial cds.758003232 (6)gb:AC012329_15375742e-36Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence.
JMSF031P03Sequence655003891 (6)gb:AY039569_15602823e-42Arabidopsis thaliana AT3g49400/F2K15_260 mRNA, partial cds.741003232 (6)gb:AC012329_15375745e-36Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence.
JMSF052D17Sequence860003232 (6)gb:AC012329_15375744e-39Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052D17+ AGGCCTCCAGACATCTCCCGAGGATTGCATC
                      ____________________________________________________________
consensus AGGCCTCCAGACATCTCCCGAGGATTGCATC
 
. : . : . : . : . : . :
rJMSF020H11+ TCAGGTAGCGNTGAAGAAGCCGGAGG
rJMSF030O15+ GG
rJMSF031O03+ CAACATCATTACCCATCAGGTAGCGTTGAAGAAGCCGGAGG
rJMSF031P03+ TCAGGTAGCGTTGAAGAAGCCGGAGG
rJMSF052D17+ CCCGAGTGTTGCAACTCCTCAACATCATTACCAATCAGGTAGNGTTGAAGAAGCCGGAGG
                      ____________________________________________________________
consensus CCCGAGTGTTGCAACTCCTCAACATCATTACCCATCAGGTAGCGTTGAAGAAGCCGGAGG
 
. : . : . : . : . : . :
rJMSF020H11+ CAGATAAAACGATCAGCGANCAGTGTGACTTGAGAAGTTCCAACGAAGCTGAAGAGGAAC
rJMSF030O15+ CAGATAAAACGATCAGCGAACAGTGTGACTTGAGAACTTCCAACGAAGCTGAAGAGGAAC
rJMSF031O03+ CAGAT-AAACGATCAGCGAACAGTGTGACTTGAGAAGTTCCAACGAAGCTGAAGAGGAAC
rJMSF031P03+ CAGATAAAACGATCAGCGAACAGTGTGACTTGAGAAGTTCCAACGAAGCTGAAGAGGAAC
rJMSF052D17+ CAGATAAAACGATCAGCGAACAGTGTGACTTGAGAAGTTCCAACGAAGCTGAAGAGGAAC
                      ____________________________________________________________
consensus CAGATAAAACGATCAGCGAACAGTGTGACTTGAGAAGTTCCAACGAAGCTGAAGAGGAAC
 
. : . : . : . : . : . :
rJMSF020H11+ AAATGACGTTGTGGATGCAATTGCAATCGAACATTGAAAAGGAATTAAGGGAACGGCTCG
rJMSF030O15+ AAATGACGTTGTGGATGCAATTGCAATCGAACA-TGAAAAGGAATTAAGGGAACGGCTCG
rJMSF031O03+ AAATGACGTTGTGGATGCAATTGCAATCGAACATTGAAAAGGAATTAAGGGAACGGCTCG
rJMSF031P03+ AAATGACGTTGTGGATGCAATTGCAATCGAACATTGAAAAGGAATTAAGGGAACGGCTCG
rJMSF052D17+ AAATGACGTTGTGGATGCAATTGCAATCGAACATTGAAAAGGAATTAAGGGAACGGCTCG
                      ____________________________________________________________
consensus AAATGACGTTGTGGATGCAATTGCAATCGAACATTGAAAAGGAATTAAGGGAACGGCTCG
 
. : . : . : . : . : . :
rJMSF020H11+ TTGGGTTAAGCCTGTCTGTTATTTTGAGTCTCGTATCTAATTCTAATGAGAATAATGGTC
rJMSF030O15+ TTGGGTTAAGCCTGTCTGTTATTTTGAGTCTCGTATCTAATTCTAATGAGAATAATGGTC
rJMSF031O03+ TTGGGTTAAGCCTGTCTGTTATTTTGAGTCTCGTATCTAATTCTAATGAGAATAATGGTC
rJMSF031P03+ TTGGGTTAAGCCTGTCTGTTATTTTGAGTCTCGTATCTAATTCTAATGAGAATAATGGTC
rJMSF052D17+ TTGGGTTAAGCCTGTCTGTTATTTTGAGTCTCGTATCTAATTCTAATGAGAATAATGGTC
                      ____________________________________________________________
consensus TTGGGTTAAGCCTGTCTGTTATTTTGAGTCTCGTATCTAATTCTAATGAGAATAATGGTC
 
. : . : . : . : . : . :
rJMSF020H11+ ACGAGGAGTTTGGATGTTGGACTCCTATTGGATCAGCGCAGATGGAGAAATGGGTCAATC
rJMSF030O15+ ACGAGGAGTTTGGATGTTGGACTCCTATTGGATCAGCGCAGATGGAGAAATGGGTCAATC
rJMSF031O03+ ACGAGGAGTTTGGATGTTGGACTCCTATTGGATCAGCGCAGATGGAGAAATGGGTCAATC
rJMSF031P03+ ACGAGGAGTTTGGATGTTGGACTCCTATTGGATCAGCGCAGATGGAGAAATGGGTCAATC
rJMSF052D17+ ACGAGGAGTTTGGATGTTGGACTCCTATTGGATCAGCGCAGATGGAGAAATGGGTCAATC
                      ____________________________________________________________
consensus ACGAGGAGTTTGGATGTTGGACTCCTATTGGATCAGCGCAGATGGAGAAATGGGTCAATC
 
. : . : . : . : . : . :
rJMSF020H11+ TTAATAGAGCAGATGTGAACGAGCATCTAAAACTCCTCGCAGAAAAAGTTGGAAAAACCA
rJMSF030O15+ TTAATAGAGCAGATGTGAACGAGCATCTAAAACTCCTCGCAGAAAAAGTTGGAAAAACCA
rJMSF031O03+ TTAATAGAGCAGATGTGAACGAGCATCTAAAACTCCTCGCAGAAAAAGTTGGAAAAACCA
rJMSF031P03+ TTAATAGAGCAGATGTGAACGAGCATCTAAAACTCCTCGCAGAAAAAGTTGGAAAAACCA
rJMSF052D17+ TTAATAGAGCAGATGTGAACGAGCATCTAAAACTCCTCGCAGAAAAAGTTGGAAAAACCA
                      ____________________________________________________________
consensus TTAATAGAGCAGATGTGAACGAGCATCTAAAACTCCTCGCAGAAAAAGTTGGAAAAACCA
 
. : . : . : . : . : . :
rJMSF020H11+ AGAAAAGAAAACTTCGCTCCATTTGCGAATACAAAACGGAAGAGGAATGCAACTTCTGCT
rJMSF030O15+ AGAAAAGAAAACTTCGCTCCATTTGCGAATACAAAACGGAAGAGGAATGCAACTTCTGCT
rJMSF031O03+ AGAAAAGAAAACTTCGCTCCATTTGCGAATACAAAACGGAAGAGGAATGCAACTTCTGCT
rJMSF031P03+ AGAAAAGAAAACTTCGCTCCATTTGCGAATACAAAACGGAAGAGGAATGCAACTTCTGCT
rJMSF052D17+ AGAAAAGAAAACTTCGCTCCATTTGCGAATACAAAACGGAAGAGGAATGCAACTTCTGCT
JMFS044G05- AGAGGAATGCAACTTCTGCT
                      ____________________________________________________________
consensus AGAAAAGAAAACTTCGCTCCATTTGCGAATACAAAACGGAAGAGGAATGCAACTTCTGCT
 
. : . : . : . : . : . :
rJMSF020H11+ CGGCTTTAGTTCCATTAGACTCTCCAGAAAACGCGTTTTGTCGAGGAGAGAAGACCGATG
rJMSF030O15+ CGGCTTTAGTTCCATTAGACTCTCCAGAAAACGCGTTTTGTCGAGGAGAGAAGACCGATG
rJMSF031O03+ CGGCTTTAGTTCCATTAGACTCTCCAGAAAACGCGTTTTGTCGAGGAGAGAAGACCGATG
rJMSF031P03+ CGGCTTTAGTTCCATTAGACTCTCCAGAAAACGCGTTTTGTCGAGGAGAGAAGACCGATG
rJMSF052D17+ CGGCTTTAGTTCCATTAGACTCTCCAGAAAACGCGTTTTGTCGAGGAGAGAAGACNGATG
JMFS044G05- CGGCTTTAGTTCCATTAGACTCTCCAGAAAACGCGTTTTGTCGAGGAGAGAAGACCGATG
                      ____________________________________________________________
consensus CGGCTTTAGTTCCATTAGACTCTCCAGAAAACGCGTTTTGTCGAGGAGAGAAGACCGATG
 
. : . : . : . : . : . :
rJMSF020H11+ CTGGAACCGGACCGAGTCATAAGCTGTTGCGCTGTGCTGTTTCCATGCGGGTATGCCTCC
rJMSF030O15+ CTGGAACCGGACCGAGTCATAAGCTGTTGCGCTGTGCTGTTTCCATGCGGGTATGCCTCC
rJMSF031O03+ CTGGAACCGGACCGAGTCATAAGCTGTTGCGCTGTGCTGTTTCCATGCGGGTATGCCTCC
rJMSF031P03+ CTGGAACCGGACCGAGTCATAAGCTGTTGCGCTGTGCTGTTTCCATGCGGGTATGCCTCC
rJMSF052D17+ CTGGAACCGGACCGAGTCATAAGCTGTTGCGCTGTGCTGTTTCCATGCGGGTATGCCTCC
JMFS044G05- CTGGAACCGGACCGAGTCATAAGCTGTTGCGCTGTGCTGTTTCCATGCGGGTATGCCTCC
                      ____________________________________________________________
consensus CTGGAACCGGACCGAGTCATAAGCTGTTGCGCTGTGCTGTTTCCATGCGGGTATGCCTCC
 
. : . : . : . : . : . :
rJMSF020H11+ CGACTCCTTCATGGCATTGCGTGTGTTGTAAGAGATCGGCCTCACAACTCGTGCCATCGG
rJMSF030O15+ CGACTCCTTCATGGCATTGCGTGTGTTGTAAGAGATCGGCCTCACAACTCGTGCCATCGG
rJMSF031O03+ CGACTCCTTCATGGCATTGCGTGTGTTGTAAGAGATCGGCCTCACAACTCGTGCCATCGG
rJMSF031P03+ CGACTCCTTCATGGCATTGCGTGTGTTGTAAGAGATCGGCCTCACAACTCGTGCCATCGG
rJMSF052D17+ CGACTCCTTCATGGCATTGCGTGTGTTGTAAGAGATCGGCCTCACAACTCGTGCCATCGG
JMFS044G05- CGACTCCTTCATGGCATTGCGTGTGTTGTAAGAGATCGGCCTCACAACTCGTGCCATCGG
                      ____________________________________________________________
consensus CGACTCCTTCATGGCATTGCGTGTGTTGTAAGAGATCGGCCTCACAACTCGTGCCATCGG
 
. : . : . : . : . : . :
rJMSF020H11+ CCCTCTTTGCACTGCCAGAATATCCTTCTGATTTCGAGTCTTTTGTCGGGCGTTGCGCAC
rJMSF030O15+ CCCTCTTTGCACTGCCAGAATATCCTTCTGATTTCGAGTCTTTTGTCGGGCGTTGCGCAC
rJMSF031O03+ CCCTCTTTGCACTGCCAGAATATCCTTCTGATTTCGAGTCTTTTGTCGGGCGTTGCGCAC
rJMSF031P03+ CCCTCTTTGCACTGCCAGAATATCCTTCTGATTTCGAGTCTTTTGTCGGGCGTTGCGCAC
rJMSF052D17+ CCCTCTTTGCACTGCCAGAATATCCTTCTGATTTCGAGTCTTTTGTCGGGCGTTGCGCAC
JMFS044G05- CCCTCTTTGCACTGCCAGAATATCCTTCTGATTTCGAGTCTTTTGTCGGGCGTTGCGCAC
                      ____________________________________________________________
consensus CCCTCTTTGCACTGCCAGAATATCCTTCTGATTTCGAGTCTTTTGTCGGGCGTTGCGCAC
 
. : . : . : . : . : . :
rJMSF020H11+ ACGAAAAACCAGTGAAACCTTTGTGTCCTTTTTGTGGGATTCTTGTGCAGAGACTGCAAC
rJMSF030O15+ ACGAAAAACCAGTGAAACCTTTGTGTCCTTTTTGTGGGATTCTTGTGCAGAGACTGCAAC
rJMSF031O03+ ACGAAAAACCAGTGAAACCTTTGTGTCCTTTTTGTGGGATTCTTGTGCAGAGACTGCAAC
rJMSF031P03+ ACGAAAAACCAGTGAAACCTTTGTGTCCTTTTTGTGGGATTCTTGTGCAGAGACTGCAAC
rJMSF052D17+ ACGAAAAACCAGTGAAACCTTTGTGTCCTTTTTGTGGGATTCTTGTGCAGAGACTGCAAC
JMFS044G05- ACGAAAAACCAGTGAAACCTTTGTGTCCTTTTTGTGGGATTCTTGTGCAGAGACTGCAAC
                      ____________________________________________________________
consensus ACGAAAAACCAGTGAAACCTTTGTGTCCTTTTTGTGGGATTCTTGTGCAGAGACTGCAAC
 
. : . : . : . : . : . :
rJMSF020H11+ CGGAATTTCTATTGTCTCCATCT-CCGGTGTAGATTGTATCTTATGTAGAACTTAAACGC
rJMSF030O15+ CGGAATTTCTATTGTCTCCATCT-CCGGTGTAGATTGTATCTTATGTAGAACTTAAACGC
rJMSF031O03+ CGGAATTTCTATTGTCTCCATCT-CCGGTGTAGATTGTATCTTATGTAGAACT
rJMSF031P03+ CGGAATTTCTATTGTCTCCATCTCCCGGTGTAGATTGTATCTTATGTAGAACT
rJMSF052D17+ CGGAATTTCTATTGTCTCCATCT-CCGGTGTAGATTGTATCTTATGTAGAACTTAAACGC
JMFS044G05- CGGAATTTCTATTGTCTCCATCT-CCGGTGTAGATTGTATCTTATGTAGAACTTAAACGC
                      ____________________________________________________________
consensus CGGAATTTCTATTGTCTCCATCT-CCGGTGTAGATTGTATCTTATGTAGAACTTAAACGC
 
. : . : . : . : . : . :
rJMSF020H11+ TAACTTCGAGTTAGGCTAATTTCAGATCTTGTATGTAACATT
rJMSF030O15+ TAACTTCGAGTTAGGCTAATTTCAGATCTTGTATGTAACATT
rJMSF052D17+ TAACTTCGAGTTAGGCTAATTTCAGATCTTGTATGTAACATTAGCTTT
JMFS044G05- TAACTTCGAGTTAGGCTAATTTCAGATCTTGTATGTAACATTAGCTTTTACTATCATTTC
                      ____________________________________________________________
consensus TAACTTCGAGTTAGGCTAATTTCAGATCTTGTATGTAACATTAGCTTTTACTATCATTTC