Previous Contig 003217:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS043G03Sequence616003217 (3)
JMSF008H13Sequence447003217 (3)711011444 (3)gb:AF481952_18039373e-33Petunia x hybrida hairy meristem (HAM) mRNA, complete cds.
JMSF032B14Sequence655003217 (3)719011444 (3)gb:AF481952_18039373e-39Petunia x hybrida hairy meristem (HAM) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032B14+ CCCACGCACTTTTCTTTAGCCTCCATAGTTTGAGTG
                      ____________________________________________________________
consensus CCCACGCACTTTTCTTTAGCCTCCATAGTTTGAGTG
 
. : . : . : . : . : . :
JMSF032B14+ GTAGTGGCGATGGGCGGAGCCACTAGGCTTGCCGTTTTATACCCACCGCCGCCGCCGTGG
                      ____________________________________________________________
consensus GTAGTGGCGATGGGCGGAGCCACTAGGCTTGCCGTTTTATACCCACCGCCGCCGCCGTGG
 
. : . : . : . : . : . :
JMSF008H13+ AGAACGGAA
JMSF032B14+ GAGGAGGAGGAAGCGGAGGTGGAAGTGGAGGGGCTAGGACTCCTTGTATCCAGAACGGAA
JMFS043G03+ AGAACGGAA
                      ____________________________________________________________
consensus GAGGAGGAGGAAGCGGAGGTGGAAGTGGAGGGGCTAGGACTCCTTGTATCCAGAACGGAA
 
. : . : . : . : . : . :
JMSF008H13+ ACCGGTTCACTGCTCGCAAAGCCGCCATTTTTCTTGAACTTGGCCGCATCTGGGGGCACC
JMSF032B14+ ACCGGTTCACTGCTCGCAAAGCCGCCATTTTTCTTGAACTTGGCCGCATCTGGGGGCACC
JMFS043G03+ ACCGGTTCACTGCTCGCANAGCCGCCATTTTTCTTGAACTTGGCCGCATCTGGGGGCACC
                      ____________________________________________________________
consensus ACCGGTTCACTGCTCGCAAAGCCGCCATTTTTCTTGAACTTGGCCGCATCTGGGGGCACC
 
. : . : . : . : . : . :
JMSF008H13+ AAGGAGGAAGAAATTGCAGACCCAAACCGTGAAACTTCAACGACACTTTTCCCCTGCAAG
JMSF032B14+ AAGGAGGAAGAAATTGCAGACCCAAACCGTGAAACTTCAACGACACTTTTCCCCTGCAAG
JMFS043G03+ AAGGAGGAAGAAATTGCAGACCCAAACCGTGAAACTTCAACGACACTTTTCCCCTGCAAG
                      ____________________________________________________________
consensus AAGGAGGAAGAAATTGCAGACCCAAACCGTGAAACTTCAACGACACTTTTCCCCTGCAAG
 
. : . : . : . : . : . :
JMSF008H13+ CTATTGCTATTATACTGCATTCCTATCATCTGCAAATGCAAGAAACCTGAGAAAAAACAC
JMSF032B14+ CTATTGCTATTATACTGCATTCCTATCATCTGCAAATGCAAGAAACCTGAGAAAAAACAC
JMFS043G03+ CTATTGCTATTATACTGCATTCCTATCATCTGCAAATGCAAGAAACCTGAGAAAAAACAC
                      ____________________________________________________________
consensus CTATTGCTATTATACTGCATTCCTATCATCTGCAAATGCAAGAAACCTGAGAAAAAACAC
 
. : . : . : . : . : . :
JMSF008H13+ AAAAAAATCCCCAGAACCCAATACCAAATCTCAAGTTCAATAGAGATCCAGGAGAAACAA
JMSF032B14+ AAAAAAATCCCCAGAACCCAATACCAAATCTCAAGTTCAATAGAGATCCAGGAGAAACAA
JMFS043G03+ AAAAAAATCCCCAGAACCCAATACCAAATCTCAAGTTCAATAGAGATCCAGGAGAAACAA
                      ____________________________________________________________
consensus AAAAAAATCCCCAGAACCCAATACCAAATCTCAAGTTCAATAGAGATCCAGGAGAAACAA
 
. : . : . : . : . : . :
JMSF008H13+ AACCACAAAATAGAGCTTCTTCAATGGCAGAGAAGACTCAAAGGCTTCAAAGCTATGAAC
JMSF032B14+ AACCACAAAATAGAGCTTCTTCAATGGCAGAGAAGACTCAAAGGCTTCAAAGCTATGAAC
JMFS043G03+ AACCACAAAATAGAGCTTCTTCAATGGCAGAGAAGACTCAAAGGCTTCAAAGCTATGAAC
                      ____________________________________________________________
consensus AACCACAAAATAGAGCTTCTTCAATGGCAGAGAAGACTCAAAGGCTTCAAAGCTATGAAC
 
. : . : . : . : . : . :
JMSF008H13+ TTTACACTCCGGGCATCTTTCTTTCCCAGTAACTTAGCCATACCACCATTGCAGAAGCTC
JMSF032B14+ TTTACACTCCGGGCATCTTTCTTTCCCAGTAACTTAGCCATACCACCATTGCAGAAGCTC
JMFS043G03+ TTTACACTCCGGGCATCTTTCTTTCCCAGTAACTTAGCCATACCACCATTGCAGAAGCTC
                      ____________________________________________________________
consensus TTTACACTCCGGGCATCTTTCTTTCCCAGTAACTTAGCCATACCACCATTGCAGAAGCTC
 
. : . : . : . : . : . :
JMSF008H13+ CATTCTCTAGTCTCTACACCATACCTCACCCCCCTTGCACCTTTTTCACAATTTCACCCT
JMSF032B14+ CATTCTCTAGTCTCTACACCATACCTCACCCCCCTTGCACCTTTTTCACAATTTCACCCT
JMFS043G03+ CATTCTCTAGTCTCTACACCATACCTCACCCCCCTTGCACCTTTTTCACAATTTCACCCT
                      ____________________________________________________________
consensus CATTCTCTAGTCTCTACACCATACCTCACCCCCCTTGCACCTTTTTCACAATTTCACCCT
 
. : . : . : . : . : . :
JMSF008H13+ GCAAATTGTAATCTTTC
JMSF032B14+ GCAAATTGTAATCTTTCACTCTTTTTTTGGGTCTTTCCTGAGTCTATATCACAACTCCCT
JMFS043G03+ GCAAATTGTAATCTTTCACTCTTTTTTTGGGTCTTTCCTGAGTCTATATCACAACTCCCT
                      ____________________________________________________________
consensus GCAAATTGTAATCTTTCACTCTTTTTTTGGGTCTTTCCTGAGTCTATATCACAACTCCCT
 
. : . : . : . : . : . :
JMSF032B14+ AGGCAAGGTCGCTGGGCT
JMFS043G03+ AGGCAAGGTCGCTGGGCTAGGCTTTCTTTTCTTTGATTTTCTTGGTTTTTATACAGTTCT
                      ____________________________________________________________
consensus AGGCAAGGTCGCTGGGCTAGGCTTTCTTTTCTTTGATTTTCTTGGTTTTTATACAGTTCT
 
. : . : . : . : . : . :
JMFS043G03+ GGGTTGCCTAGCTCGCTAGTCGCTAGGCTACACCACTTTTTGTGTTACTGTTCTGTGCTG
                      ____________________________________________________________
consensus GGGTTGCCTAGCTCGCTAGTCGCTAGGCTACACCACTTTTTGTGTTACTGTTCTGTGCTG