Previous Contig 003214:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012P12Sequence417000685 (2)796003214 (4)pir|T02594|T025946e-38hypothetical protein At2g14820 [imported] - Arabidopsis thaliana>gb:AC004705_153
JMFF037H16Sequence505000685 (2)800003214 (4)pir|T02594|T025942e-38hypothetical protein At2g14820 [imported] - Arabidopsis thaliana>gb:AC004705_153
JMFS043F04Sequence589003214 (4)gb:AC135500_17424382e-05Oryza sativa chromosome 3 BAC OSJNBa0034J04 genomic sequence, complete sequence.
JMFS046G11Sequence532003214 (4)gb:AC135500_17424380.008Oryza sativa chromosome 3 BAC OSJNBa0034J04 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF012P12+ TCAGCAAGAGCGAGAGGAAGAGAATCTGCAGGTTGATGGACTGCA
rJMFF037H16+ GGATCAGCAAGAGCGAGAGGAAGAGAATCTGCAGGTTGATGGACTGCA
                      ____________________________________________________________
consensus GGATCAGCAAGAGCGAGAGGAAGAGAATCTGCAGGTTGATGGACTGCA
 
. : . : . : . : . : . :
rJMFF012P12+ AGAAGCTTTCTGCAGATGCATGCATGCACGCAGTTCAGAACGAGAGGCTCCCTCTGCGTG
rJMFF037H16+ AGAAGCTTTCTGCAGATGCATGCATGCACGCAGTTCAGAACGAGAGGCTCCCTCTGCGTG
                      ____________________________________________________________
consensus AGAAGCTTTCTGCAGATGCATGCATGCACGCAGTTCAGAACGAGAGGCTCCCTCTGCGTG
 
. : . : . : . : . : . :
rJMFF012P12+ TCGTTGTGCAGGTGCTGTTCTTCGAGCAAGTCCGGGCTAATGCATCATCCGGAAGTAGCA
rJMFF037H16+ TCGTTGTGCAGGTGCTGTTCTTCGAGCAAGTCCGGGCTAATGCATCATCCGGAAGTAGCA
                      ____________________________________________________________
consensus TCGTTGTGCAGGTGCTGTTCTTCGAGCAAGTCCGGGCTAATGCATCATCCGGAAGTAGCA
 
. : . : . : . : . : . :
rJMFF012P12+ CGCCCGACCTGCCAAAAGCCATAAAGGACCTCAACTGTGCCTCCTATGGCAGCTCGAGAT
rJMFF037H16+ CGCCCGACCTGCCAAAAGCCATAAAGGACCTCAACTGTGCCTCCTATGGCAGCTCGAGAT
                      ____________________________________________________________
consensus CGCCCGACCTGCCAAAAGCCATAAAGGACCTCAACTGTGCCTCCTATGGCAGCTCGAGAT
 
. : . : . : . : . : . :
rJMFF012P12+ CTGCAACGACTACGACCGAGGAAGACTGGGATGGCGTCGCCTCTGCTGACGAGCTCAGAG
rJMFF037H16+ CTGCAACGACTACGACCGAGGAAGACTGGGATGGCGTCGCCTCTGCTGACGAGCTCAGAG
JMFS046G11+ AG
JMFS043F04+ ACGACCGAGGAAGACTGGGATGGCGTCGCCTCTGCTGACGAGCTCAGAG
                      ____________________________________________________________
consensus CTGCAACGACTACGACCGAGGAAGACTGGGATGGCGTCGCCTCTGCTGACGAGCTCAGAG
 
. : . : . : . : . : . :
rJMFF012P12+ CTTTGAAAGGCGAGCTGGCAGCTTTACGGTTGGGAAATGCAGGAATGGCTGATAGAGCCA
rJMFF037H16+ CTTTGAAAGGCGAGCTGGCAGCTTTACGGTTGGGAAATGCAGGAATGGCTGATAGAGCCA
JMFS046G11+ CTTTGAAAGGCGAGCTGGCAGCTTTACGGTTGGGAAATGCAGGAATGGCTGATAGAGCCA
JMFS043F04+ CTTTGAAAGGCGAGCTGGCAGCTTTACGGTTGGGAAATGCAGGAATGGCTGATAGAGCCA
                      ____________________________________________________________
consensus CTTTGAAAGGCGAGCTGGCAGCTTTACGGTTGGGAAATGCAGGAATGGCTGATAGAGCCA
 
. : . : . : . : . : . :
rJMFF012P12+ ATGGAGATACTACTAAGACTGTCGCCTCCTCCGACAAGGCTGCTGCCATCAGTAAAATGA
rJMFF037H16+ ATGGAGATACTACTAAGACTGTCGCCTCCTCCGACAAGGCTGCTGCCATCAGTAAAATGA
JMFS046G11+ ATGGAGATACTACTAAGACTGTCGCCTCCTCCGACAAGGCTGCTGCCATCAGTAAAATGA
JMFS043F04+ ATGGAGATACTACTAAGACTGTCGCCTCCTCCGACAAGGCTGCTGCCATCAGTAAAATGA
                      ____________________________________________________________
consensus ATGGAGATACTACTAAGACTGTCGCCTCCTCCGACAAGGCTGCTGCCATCAGTAAAATGA
 
. : . : . : . : . : . :
rJMFF012P12+ AAGGCTTACTTGTTTCGAAGAGGATCTTCTCCAAAATCTGGTCTAGTAAAGGTGGAAATG
rJMFF037H16+ AAGGCTTACTTGTTTCGAAGAGGATCTTCTCCAAAATCTGGTCTAGTAAAGGTGGAAATG
JMFS046G11+ AAGGCTTACTTGTTTCGAAGAGGATCTTCTCCAAAATCTGGTCTAGTAAAGGTGGAAATG
JMFS043F04+ AAGGCTTACTTGTTTCGAAGAGGATCTTCTCCAAAATCTGGTCTAGTAAAGGTGGAAATG
                      ____________________________________________________________
consensus AAGGCTTACTTGTTTCGAAGAGGATCTTCTCCAAAATCTGGTCTAGTAAAGGTGGAAATG
 
. : . : . : . : . : . :
rJMFF012P12+ GGGAGAACAGTGGCTCTGATTCGTCGGAAAGTCTGGGCTCTACCACCATGGAAGAAGCAA
rJMFF037H16+ GGGAGAACAGTGGCTCTGATTCGTCGGAAAGTCTGGGCTCTACCACCATGGAAGAAGCAA
JMFS046G11+ GGGAGAACAGTGGCTCTGATTCGTCGGAAAGTCTGGGCTCTACCACCATGGAAGAAGCAA
JMFS043F04+ GGGAGAACAGTGGCTCTGATTCGTCGGAAAGTCTGGGCTCTACCACCATGGAAGAAGCAA
                      ____________________________________________________________
consensus GGGAGAACAGTGGCTCTGATTCGTCGGAAAGTCTGGGCTCTACCACCATGGAAGAAGCAA
 
. : . : . : . : . : . :
rJMFF012P12+ AATCCACCCCTTCAAGGAAGGGCAGATATTCTGTTTCTTAGTTCAATATCTGAAGATGTA
rJMFF037H16+ AATCCACCCCTTCAAGGAAGGGCAGATATTCTGTTTCTTAGTTCAATATCTGAAGATGTA
JMFS046G11+ AATCCACCCCTTCAAGGAAGGGCAGATATTCTGTTTCTTAGTTCAATATCTGAAGATGTA
JMFS043F04+ AATCCACCCCTTCAAGGAAGGGCAGATATTCTGTTTCTTAGTTCAATATCTGAAGATGTA
                      ____________________________________________________________
consensus AATCCACCCCTTCAAGGAAGGGCAGATATTCTGTTTCTTAGTTCAATATCTGAAGATGTA
 
. : . : . : . : . : . :
rJMFF012P12+ TAGATATCTAAGCTTATAGCCTTATTAGTTCACAGAATGACAGTTCCATTCCAGGTCAAA
rJMFF037H16+ TAGATATCTAAGCTTATAGCCTTATTAGTTCACAGAATGACAGTTCCATTCCAGGTCAAA
JMFS046G11+ TAGATATCTAAGCTTATAGCCTTATTAGTTCACAGAATGACAGTTCCATTCCAGGTCAAA
JMFS043F04+ TAGATATCTAAGCTTATAGCCTTATTAGTTCACAGAATGACAGTTCCATTCCAGGTCAAA
                      ____________________________________________________________
consensus TAGATATCTAAGCTTATAGCCTTATTAGTTCACAGAATGACAGTTCCATTCCAGGTCAAA
 
. : . : . : . : . : . :
rJMFF012P12+ TCCAAAAGGAATTGCCATTCTCATTTTCACTTAGACATGTTTTCTAGGGCTAGTTTGAGC
rJMFF037H16+ TCCAAAAGGAATTGCCATTCTCATTTTCACTTAGACATGTTTTCTAGGGCTAGTTTGAGC
JMFS046G11+ TCCAAAAGGAATTGCCATTTTCATTTTCACTTAGACATGTTTTTTAGGGCTAGTTTGAGC
JMFS043F04+ TCCAAAAGGAATTGCCATTCTCATTTTCACTTAGACATGTTTTCTAGGGCTAGTTTGAGC
                      ____________________________________________________________
consensus TCCAAAAGGAATTGCCATTCTCATTTTCACTTAGACATGTTTTCTAGGGCTAGTTTGAGC
 
. : . : . : . : . : . :
rJMFF012P12+ CTAACCATTAGCAATATGGTTTCACAAGGAAGATCACTGTACTTTGGACCCATAATACAA
rJMFF037H16+ CTAACCATTAGCAATATGGTTTCACAAGGAAGATCACTGTACTTTGGACCCATAATACAA
JMFS046G11+ CTAACCATTAGCAATATGGTTTCTCAAGGAAGATCAATGTACTTTGGTCCCATAATACAA
JMFS043F04+ CTAACCATTAGCAATATGGTTTCACAAGGAAGATCACTGTACTTTGGACCCATAATACAA
                      ____________________________________________________________
consensus CTAACCATTAGCAATATGGTTTCACAAGGAAGATCACTGTACTTTGGACCCATAATACAA
 
. : . : . : . : . : . :
rJMFF012P12+ ATTGCATGAGCCAAAAAACAAT
rJMFF037H16+ ATTGCATGAGCCAAAAAACAATTAAGCGGAT
JMFS046G11+ ATTGCATGAGCCAAAAAACAATTAAGCGGATTGTTAAAATAAATGCAAGA
JMFS043F04+ ATTGCATGAGCCAAAAAACAATTAAGCGGATTGTTAATATAATTGCAAGACTAGAAGATT
                      ____________________________________________________________
consensus ATTGCATGAGCCAAAAAACAATTAAGCGGATTGTTAATATAATTGCAAGACTAGAAGATT