Previous Contig 003209:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS043B03Sequence627003209 (5)
JMSF021M17Sequence621003209 (5)sp|P37272|PSY_CAPAN6e-04Phytoene synthase, chloroplast precursor (EC 2.5.1.-).>gb:CAPSY1_1645111 C.annuu776012218 (5)pir|A49558|A49558e-100phytoene synthase 2 precursor - tomato (fragment)
JMSF024J21Sequence645003209 (5)sp|P37272|PSY_CAPAN7e-13Phytoene synthase, chloroplast precursor (EC 2.5.1.-).>gb:CAPSY1_1645111 C.annuu791012218 (5)pir|A49558|A49558e-121phytoene synthase 2 precursor - tomato (fragment)
JMSF038P07Sequence621003209 (5)sp|P37272|PSY_CAPAN6e-04Phytoene synthase, chloroplast precursor (EC 2.5.1.-).>gb:CAPSY1_1645111 C.annuu907012218 (5)pir|A49558|A49558e-138phytoene synthase 2 precursor - tomato (fragment)
JMSF051G16Sequence592003209 (5)gb:AF152892_17728160.010Citrus x paradisi phytoene synthase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024J21+ TCCTGTT
                      ____________________________________________________________
consensus TCCTGTT
 
. : . : . : . : . : . :
JMSF024J21+ CACCAAAGCAGCCTGCTTCAACACTACATCGTAGACCTTTTGCTCGGATGACATCACCAT
                      ____________________________________________________________
consensus CACCAAAGCAGCCTGCTTCAACACTACATCGTAGACCTTTTGCTCGGATGACATCACCAT
 
. : . : . : . : . : . :
JMSF038P07+ TTCGA
JMSF024J21+ TTCCCCGGCTGGACTAACCACCGCATTCGAAAGCACGGGGAATTTCCCTCCATTCTTCGA
                      ____________________________________________________________
consensus TTCCCCGGCTGGACTAACCACCGCATTCGAAAGCACGGGGAATTTCCCTCCATTCTTCGA
 
. : . : . : . : . : . :
JMSF038P07+ GCCCGACCCTCCCGAACAAAGATATCTCGAGTCTGCATTGAAAGACGCCAAAGTGCATCC
JMSF024J21+ GCCCGACCCTCCCGAACAAAGATATCTCGAGTCTGCATTGAAAGACGCCAAAGTGCATCC
                      ____________________________________________________________
consensus GCCCGACCCTCCCGAACAAAGATATCTCGAGTCTGCATTGAAAGACGCCAAAGTGCATCC
 
. : . : . : . : . : . :
JMSF038P07+ TTGCTTCTTACCCTTCTTAGCCCTGCCTTTGCCCACCAAACTCGTGTTCCTGCCAAGGAA
JMSF051G16+ TTTGCCCACCAAACTCGTGTTCCTGCCAAGGAA
JMSF021M17+ TTCTTAGCCCTGCCTTTGCCCACCAAACTCGTGTTCCTGCCAAGGAA
JMSF024J21+ TTGCTTCTTACCCTTCTTAGCCCTGCCTTTGCCCACCAAACTCGTGTTCCTGCCAAGGAA
                      ____________________________________________________________
consensus TTGCTTCTTACCCTTCTTAGCCCTGCCTTTGCCCACCAAACTCGTGTTCCTGCCAAGGAA
 
. : . : . : . : . : . :
JMSF038P07+ CCTCGATGAATCCACGACCCGGATTCCCTCCCTCACCGAATAAAAGATTCCAGTGCCATT
JMSF051G16+ CCTCGATGAATNCACGACCCGGATTCCCTCCCTCACCGAATAAAAGATTCCAGTGCCATN
JMSF021M17+ CCTCGATGAATCCACGACCCGGATTCCCTCCCTCACCGAATAAAAGATTCCAGTGCCATT
JMSF024J21+ CCTCGATGAATCCACGACCCGGATTCCCTCCCTCACCGAATAAAAGATTCCAGTGCCATT
                      ____________________________________________________________
consensus CCTCGATGAATCCACGACCCGGATTCCCTCCCTCACCGAATAAAAGATTCCAGTGCCATT
 
. : . : . : . : . : . :
JMSF038P07+ TGATAGCTCAGAAGAGGGAGAAACAACCCACAGCAAGGCACTAGACATACTTGAGGTGAA
JMSF051G16+ TGATAGCTCNGAAGAGGGAGAAACAACCCACAGCAAGGCACTAGACATACTTGAGGTGAA
JMSF021M17+ TGATAGCTCAGAAGAGGGAGAAACAACCCACAGCAAGGCACTAGACATACTTGAGGTGAA
JMSF024J21+ TGATAGCTCAGAAGAGGGAGAAACAACCCACAGCAAGGCACTAGACATACTTGAGGTGAA
JMFS043B03+ AGCAAGGCACTAGACATACTTGAGGTGAA
                      ____________________________________________________________
consensus TGATAGCTCAGAAGAGGGAGAAACAACCCACAGCAAGGCACTAGACATACTTGAGGTGAA
 
. : . : . : . : . : . :
JMSF038P07+ ATAGTTTGTATATAACTACTTCCAAGATTTTGTATTTATGTTCCCTTGATTATCCTGGTG
JMSF051G16+ ATAGTTTGTATATAACTACTTCCAAGATTTNGTATTTATGTTCCCTTGATTATCCTGGTG
JMSF021M17+ ATAGTTTGTATATAACTACTTCCAAGATTTTGTATTTATGTTCCCTTGATTATCCTGGTG
JMSF024J21+ ATAGTTTGTATATAACTACTTCCAAGATTTTGTATTTATGTTCCCTTGATTATCCTGGTG
JMFS043B03+ ATAGTTTGTATATAACTACTTCCAAGATTTTGTATTTATGTTCCCTTGATTATCCTGGTG
                      ____________________________________________________________
consensus ATAGTTTGTATATAACTACTTCCAAGATTTTGTATTTATGTTCCCTTGATTATCCTGGTG
 
. : . : . : . : . : . :
JMSF038P07+ TGTAGTTTATAGTAAAAAATGGAATATGCCCACTAAAGTCTTTCCACTTTCAAACAATGC
JMSF051G16+ NGTAGTTTATAGTAAAAAATGGAATATGCCCACTAAAGTCTTTCCACTTTCAAACAATGC
JMSF021M17+ TGTAGTTTATAGTAAAAAATGGAATATGCCCACTAAAGTCTTTCCACTTTCAAACAATGC
JMSF024J21+ TGTAGTTTATAGTAAAAAATGGAATATGCCCACTAAAGTCTTTCCACTTTCAAACAATGC
JMFS043B03+ TGTAGTTTATAGTAAAAAATGGAATATGCCCACTAAAGTCTTTCCACTTTCAAACAATGC
                      ____________________________________________________________
consensus TGTAGTTTATAGTAAAAAATGGAATATGCCCACTAAAGTCTTTCCACTTTCAAACAATGC
 
. : . : . : . : . : . :
JMSF038P07+ CCACCTTGGCTTTTTGCAAAAGAGATCATTAAACCCCCCCACAACCAAATCAAACCGACT
JMSF051G16+ CCACCTTGGCTTTTTGCAAAAGAGATCATTAAACCCCCCCACAACCAAATCAAACCGACT
JMSF021M17+ CCACCTTGGCTTTTTGCAAAAGAGATCATTAAACCCCCCCACAACCAAATCAAACCGACT
JMSF024J21+ CCACCTTGGCTTTTTGCAAAAGAGATCATTAAACCCCCCCACAACCAAATCAAACCGACT
JMFS043B03+ CCACCTTGGCTTTTTGCAAAAGAGATCATTAAACCCCACCACAACCAAATCAAACCGACT
                      ____________________________________________________________
consensus CCACCTTGGCTTTTTGCAAAAGAGATCATTAAACCCCCCCACAACCAAATCAAACCGACT
 
. : . : . : . : . : . :
JMSF038P07+ TTGCTTTAACTGCCACAAAAAAGCAAAGGGTTTATGAATTATGAACACCAAGCTCCCCTC
JMSF051G16+ TTGCTTTAACTGCCACAAAAAAGCAAAGGGTTTATGAATTATGAACACCAAGCTCCCCTC
JMSF021M17+ TTGCTTTAACTGCCACAAAAAAGCAAAGGGTTTATGAATTATGAACACCAAGCTCCCCTC
JMSF024J21+ TTGCTTTAACTGCCACAAAAAAGCAAAGGGTTTATGAATTATGAACACCAAGCTCCCCTC
JMFS043B03+ TTGCTTTAACTGCCACAAAAAAGCAAAGGGTTTATGAATTATGAACACCAAGCTCCCCTC
                      ____________________________________________________________
consensus TTGCTTTAACTGCCACAAAAAAGCAAAGGGTTTATGAATTATGAACACCAAGCTCCCCTC
 
. : . : . : . : . : . :
JMSF038P07+ TTATCTCCTTCTGC
JMSF051G16+ TTATCTCCTTCTGC
JMSF021M17+ TTATCTCCTTCTGC
JMSF024J21+ TTATCTCCTTCTGCTTCTTTGCTCCAGAGAAAGCAAT
JMFS043B03+ TTATCTCCTTCTGC-ACAATG-AAATGAACCACAAATCAAACTAAATAACCTGCTGGGCA
                      ____________________________________________________________
consensus TTATCTCCTTCTGCTTCTTTGCTCCTGAGCCAGCAATCAAACTAAATAACCTGCTGGGCA
 
. : . : . : . : . : . :
JMFS043B03+ TACTGAATTATAGCACCATATGTCCTTTAACAAAAAAAAAAGATCAAAAAAGTCTTAAAT
                      ____________________________________________________________
consensus TACTGAATTATAGCACCATATGTCCTTTAACAAAAAAAAAAGATCAAAAAAGTCTTAAAT
 
. : . : . : . : . : . :
JMFS043B03+ CAACAACAACAGCACCTTCCCTACAGTGCTGCACAAAGAAAGGATCTTTAATATTGAGAA
                      ____________________________________________________________
consensus CAACAACAACAGCACCTTCCCTACAGTGCTGCACAAAGAAAGGATCTTTAATATTGAGAA
 
. : . : . : . : . : . :
JMFS043B03+ AAAAAAGGAAACCAATAAAATAATCTGCAAGATTATGCACCAGACATCACTTTCTTATGG
                      ____________________________________________________________
consensus AAAAAAGGAAACCAATAAAATAATCTGCAAGATTATGCACCAGACATCACTTTCTTATGG
 
. : . : . : . : . : . :
JMFS043B03+ TTATTGGGGATTTCTATATTTAGTTAAATGGAATATAATATGCAACACTTCTTGTCTTCC
                      ____________________________________________________________
consensus TTATTGGGGATTTCTATATTTAGTTAAATGGAATATAATATGCAACACTTCTTGTCTTCC
 
. : . : . : . : . : . :
JMFS043B03+ TTACACGTACGAGCTATCTTGAATGGACCAACCTTTCATATCTATTGTTGCACTATGAAG
                      ____________________________________________________________
consensus TTACACGTACGAGCTATCTTGAATGGACCAACCTTTCATATCTATTGTTGCACTATGAAG