Previous Contig 003207:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS021B01Sequence627003207 (4)
JMFS042F05Sequence605003207 (4)
JMFS094G03Sequence620003207 (4)
JMSF033D06Sequence701003207 (4)272012782 (5)gb:AP005286_18498571e-23Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033D06+ CATTACCAATG
                      ____________________________________________________________
consensus CATTACCAATG
 
. : . : . : . : . : . :
JMSF033D06+ CCCCTGCTGGAATGGTCTTTCAAATGGATAGCAGCTGCATCTTTTGGAGTTGACCAAGCA
                      ____________________________________________________________
consensus CCCCTGCTGGAATGGTCTTTCAAATGGATAGCAGCTGCATCTTTTGGAGTTGACCAAGCA
 
. : . : . : . : . : . :
JMSF033D06+ GATTGATAAGATTTTTCTTGGGTTTGACGAATCTGACTGCTGCCAACATTCTCTACTAAA
JMFS094G03+ TGACTGCTGCCAACATTCTCTACTAAA
                      ____________________________________________________________
consensus GATTGATAAGATTTTTCTTGGGTTTGACGAATCTGACTGCTGCCAACATTCTCTACTAAA
 
. : . : . : . : . : . :
JMSF033D06+ CTGGATCTGGAAGAAGGACCAGAAGGATAAAAAGAAGCAGGAAGCGCCCTCTTCTTGACA
JMFS094G03+ CTGGATCTGGAAGAAGGACCAGAAGGATAAAAAGAAGCAGGAAGCGCCCTCTTCTTGACA
JMFS021B01+ CAGAAGGATAAAAAGAAGCAGGAAGCGCCCTCTTCTTGACA
JMFS042F05+ TTGACA
                      ____________________________________________________________
consensus CTGGATCTGGAAGAAGGACCAGAAGGATAAAAAGAAGCAGGAAGCGCCCTCTTCTTGACA
 
. : . : . : . : . : . :
JMSF033D06+ TGATCATTTCTATCATCAGCAGAAGCCCTAGAACTTGAAGCTCCAAATCTATCACCATAA
JMFS094G03+ TGATCATTTCTATCATCAGCAGAAGCCCTAGAACTTGAAGCTCCAAATCTATCACCATAA
JMFS021B01+ TGATCATTTCTATCATCAGCAGAAGCCCTAGAACTTGAAGCTCCAAATCTATCACCATAA
JMFS042F05+ TGATCATTTCTATCATCAGCAGAAGCCCTAGAACTTGAAGCTCCAAATCTATCACCATAA
                      ____________________________________________________________
consensus TGATCATTTCTATCATCAGCAGAAGCCCTAGAACTTGAAGCTCCAAATCTATCACCATAA
 
. : . : . : . : . : . :
JMSF033D06+ GATGGACGCACTGAAGAGCTTGCATTCACCCCATTAAAATTAAAAGAACTTCCATTTGCA
JMFS094G03+ GATGGACGCACTGAAGAGCTTGCATTCACCCCATTAAAATTAAAAGAACTTCCATTTGCA
JMFS021B01+ GATGGACGCACTGAAGAGCTTGCATTCACCCCATTAAAATTAAAAGAACTTCCATTTGCA
JMFS042F05+ GATGGACGCACTGAAGAGCTTGCATTCACCCCATTAAAATTAAAAGAACTTCCATTTGCA
                      ____________________________________________________________
consensus GATGGACGCACTGAAGAGCTTGCATTCACCCCATTAAAATTAAAAGAACTTCCATTTGCA
 
. : . : . : . : . : . :
JMSF033D06+ GAGGCTGTTCTTTTGGGAGAAGGACCCCTTGCAGAGGGACGACTGTGATCTGATGCCCAT
JMFS094G03+ GAGGCTGTTCTTTTGGGAGAAGGACCCCTTGCAGAGGGACGACTGTGATCTGATGCCCAT
JMFS021B01+ GAGGCTGTTCTTTTGGGAGAAGGACCCCTTGCAGAGGGACGACTGTGATCTGATGCCCAT
JMFS042F05+ GAGGCTGTTCTTTTGGGAGAAGGACCCCTTGCAGAGGGACGACTGTGATCTGATGCCCAT
                      ____________________________________________________________
consensus GAGGCTGTTCTTTTGGGAGAAGGACCCCTTGCAGAGGGACGACTGTGATCTGATGCCCAT
 
. : . : . : . : . : . :
JMSF033D06+ GTTGGAAGAACCCTAAAATCAGAAGAGGCAGAGTCCACTGTAGGTGACTCATCTTTGTAT
JMFS094G03+ GTTGGAAGAACCCTAAAATCAGAAGAGGCAGAGTCCACTGTAGGTGACTCATCTTTGTAT
JMFS021B01+ GTTGGAAGAACCCTAAAATCAGAAGAGGCAGAGTCCACTGTAGGTGACTCATCTTTGTAT
JMFS042F05+ GTTGGAAGAACCCTAAAATCAGAAGAGGCAGAGTCCACTGTAGGTGACTCATCTTTGTAT
                      ____________________________________________________________
consensus GTTGGAAGAACCCTAAAATCAGAAGAGGCAGAGTCCACTGTAGGTGACTCATCTTTGTAT
 
. : . : . : . : . : . :
JMSF033D06+ TCATCTATTGCTCGCAACTCTGAATCTTCACTAGAATCGTCAGAACTGATAACAACATCT
JMFS094G03+ TCATCTATTGCTCGCAACTCTGAATCTTCACTAGAATCGTCAGAACTGATAACAACATCT
JMFS021B01+ TCATCTATTGCTCGCAACTCTGAATCTTCACTAGAATCGTCAGAACTGATAACAACATCT
JMFS042F05+ TCATCTATTGCTCGCAACTCTGAATCTTCACTAGAATCGTCAGAACTGATAACAACATCT
                      ____________________________________________________________
consensus TCATCTATTGCTCGCAACTCTGAATCTTCACTAGAATCGTCAGAACTGATAACAACATCT
 
. : . : . : . : . : . :
JMSF033D06+ ATAGGAGCCATTCAAGAAACTTAAGAGACAACCAGAAGTGGTATTTGTAATTTGTAAAAT
JMFS094G03+ ATAGGAGCCATTCAAGAAACTTAAGAGACAACCAGAAGTGGTATTTGTAATTTGTAAAAT
JMFS021B01+ ATAGGAGCCATTCAAGAAACTTAAGAGACAACCAGAAGTGGTATTTGTAATTTGTAAAAT
JMFS042F05+ ATAGGAGCCATTCAAGAAACTTAAGAGACAACCAGAAGTGGTATTTGTAATTTGTAAAAT
                      ____________________________________________________________
consensus ATAGGAGCCATTCAAGAAACTTAAGAGACAACCAGAAGTGGTATTTGTAATTTGTAAAAT
 
. : . : . : . : . : . :
JMSF033D06+ CCAATCT
JMFS094G03+ CCAATCT
JMFS021B01+ CCAATCTGTAAAAAGGTACACCTACACTCTTAAGATATGCAGCAGCTGTTCAACGTAACC
JMFS042F05+ CCAATCTGTAAAAAGGTACACCTACACTCTTAAGATATGCAGCAGCTGTTCAACGTAACC
                      ____________________________________________________________
consensus CCAATCTGTAAAAAGGTACACCTACACTCTTAAGATATGCAGCAGCTGTTCAACGTAACC
 
. : . : . : . : . : . :
JMFS021B01+ ACGCATCTAAAATAAATACATACAGCCCATTTGCCTAATATCAGACTCTGGCATTACTTC
JMFS042F05+ ACGCATCTAAAATAAATACATACAGCCCATTTGCCTAATATCAGACTCTGGCATTACTTC
                      ____________________________________________________________
consensus ACGCATCTAAAATAAATACATACAGCCCATTTGCCTAATATCAGACTCTGGCATTACTTC
 
. : . : . : . : . : . :
JMFS021B01+ TTCCTTGCTTAGCTGAAAGTTGGGAAATCGGGCTTCTTCTTCTTTTGTACGATGAATATT
JMFS042F05+ TTCCTTGCTTAGCTGAAAGTTGGGAAATCGGGCTTCTTCTTCTTTTGTACGATGAATATT
                      ____________________________________________________________
consensus TTCCTTGCTTAGCTGAAAGTTGGGAAATCGGGCTTCTTCTTCTTTTGTACGATGAATATT
 
. : . : . : . : . : . :
JMFS021B01+ TGAAAAGNCCCTAATTCGTGAAGCGAAACTGCCGCAATTGAAGTAC
JMFS042F05+ TGAAAAG-CCCTAATTCGTGAAGCGAAACTGCCGCAATTGAAGTACGACAGCAATTCACT
                      ____________________________________________________________
consensus TGAAAAGNCCCTAATTCGTGAAGCGAAACTGCCGCAATTGAAGTACGACAGCAATTCACT