Previous Contig 003206:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS026F10Sequence626003206 (7)gb:AY531661_1611944e-104Lycopersicon cheesmanii UV-damaged DNA binding protein 1 (hp1) gene, promoter an
JMFS042F04Sequence593003206 (7)gb:AY452480_16067923e-96Lycopersicon esculentum UV damaged DNA binding protein 1 (DDB1) mRNA, complete c
JMFS091H10Sequence623003206 (7)gb:AY531661_1611944e-105Lycopersicon cheesmanii UV-damaged DNA binding protein 1 (hp1) gene, promoter an
JMFS115G11Sequence622003206 (7)gb:AY531661_1611944e-102Lycopersicon cheesmanii UV-damaged DNA binding protein 1 (hp1) gene, promoter an
JMFS130C08Sequence634003206 (7)gb:AY452480_1606792e-106Lycopersicon esculentum UV damaged DNA binding protein 1 (DDB1) mRNA, complete c
JMSF025I23Sequence687003206 (7)gb:AY452480_1606792e-109Lycopersicon esculentum UV damaged DNA binding protein 1 (DDB1) mRNA, complete c771012421 (2)gb:AY531661_16119449e-62Lycopersicon cheesmanii UV-damaged DNA binding protein 1 (hp1) gene, promoter an
JMSF033C17Sequence729003206 (7)gb:AY452480_1606792e-126Lycopersicon esculentum UV damaged DNA binding protein 1 (DDB1) mRNA, complete c767012421 (2)gb:AY531661_16119441e-87Lycopersicon cheesmanii UV-damaged DNA binding protein 1 (hp1) gene, promoter an

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS115G11+ CAAATTGACATATCTTTCCANAACTTCTAC
                      ____________________________________________________________
consensus CAAATTGACATATCTTTCCANAACTTCTAC
 
. : . : . : . : . : . :
JMFS115G11+ ATAAGAGCCTTTAGCATCAGGTTGAAGATTAAGCTTTATAAGCTGAGAATCACCACAACT
                      ____________________________________________________________
consensus ATAAGAGCCTTTAGCATCAGGTTGAAGATTAAGCTTTATAAGCTGAGAATCACCACAACT
 
. : . : . : . : . : . :
JMFS115G11+ AGAGCCAATATAGACAAAAGCATTATCCAGGTATGATATTGTTGATGCAATCGAGGTTTC
JMFS091H10+ ATGATATTGTTGATGCAATCGAGGTTTC
                      ____________________________________________________________
consensus AGAGCCAATATAGACAAAAGCATTATCCAGGTATGATATTGTTGATGCAATCGAGGTTTC
 
. : . : . : . : . : . :
JMFS115G11+ TCCCAAAAGTTCAATTTTGAGTCCAGTAACTTTTTCTTTTTCATGAGTGATGACAAGTAG
JMFS091H10+ TCCCAAAAGTTCAATTTTGAGTCCAGTAACTTTTTCTTTTTCATGAGTGATGACAAGTAG
JMFS026F10+ AGTCCAGTAAC-TTTTCTTTTTCATGAGTTATAACAAGTAG
                      ____________________________________________________________
consensus TCCCAAAAGTTCAATTTTGAGTCCAGTAACTTTTTCTTTTTCATGAGTGATGACAAGTAG
 
. : . : . : . : . : . :
JMFS115G11+ GTGAAGAAGCCCATTGTGATCCCCAAGTAAATACCGAGAACCATCAGCATCAACCCTTCC
JMFS091H10+ GTGAAGAAGCCCATTGTGATCCCCAAGTAAATACCGAGAACCATCAGCATCAACCCTTCC
JMFS026F10+ ATGAAGAAGCCCATTGTGATCCCCAAGTAAATAGCGAGAACCATCAGCATCAACCCTTCC
                      ____________________________________________________________
consensus GTGAAGAAGCCCATTGTGATCCCCAAGTAAATACCGAGAACCATCAGCATCAACCCTTCC
 
. : . : . : . : . : . :
JMFS115G11+ ATAGGCTCTTGTGATGGAAGGTCTAACGGGGATTGCTTTAAAAGCTGTTGCACTGCAATA
JMFS091H10+ ATAGGCTCTTGTGATGGAAGGTCTAACGGGGATTGCTTTAAAAGCTGTTGCACTGCAATA
JMFS026F10+ ATATGCTTTTGTAGTGGAAGGTTTAATGGGAATTGCTTTAAAAGCTGTGGCACTACAATA
                      ____________________________________________________________
consensus ATAGGCTCTTGTGATGGAAGGTCTAACGGGGATTGCTTTAAAAGCTGTTGCACTGCAATA
 
. : . : . : . : . : . :
JMFS115G11+ TACAATGGTTTCTTCCCCAATAATAAGTACCCCACAAAATGGTGGGGGCACTGGGATGAG
JMFS091H10+ TACAATGGTTTCTTCCCCAATAATAAGTACCCCACAAAATGGTGGGGGCACTGGGATGAG
JMFS026F10+ TACAATGGTTTCTTCCCCAATAATAAGCACACCACAAAGGGGCGATGGCACAGGGATGAG
JMSF033C17+ GGGATGAG
                      ____________________________________________________________
consensus TACAATGGTTTCTTCCCCAATAATAAGTACCCCACAAAATGGTGGGGGCACTGGGATGAG
 
. : . : . : . : . : . :
JMFS115G11+ CAAACTCGCTCCATTATCAAGATTATTTTGAGACCATGGACCCTCAATAAAATCTTTATC
JMFS091H10+ CAAACTCGCTCCATTATCAAGATTATTTTGAGACCATGGACCCTCAATAAAATCTTTATC
JMFS026F10+ CAAATCAGCTCCATTATCAAGATTATTTTGAGACCATGGACCCTCAATAAAATCTTTATC
JMSF033C17+ CAAACTCGCTCCATTATCAAGATTATTTTGAGACCATGGACCCTCAATAAAATCTTTATC
                      ____________________________________________________________
consensus CAAACTCGCTCCATTATCAAGATTATTTTGAGACCATGGACCCTCAATAAAATCTTTATC
 
. : . : . : . : . : . :
JMFS115G11+ TTTCAAGGAAACCTCATATGTTTTGATATGACGAGCATCCTTGTTATCCTGGTAAAGAAC
JMFS091H10+ TTTCAAGGAAACCTCATATGTTTTGATATGACGAGCATCCTTGTTATCCTGGTAAAGAAC
JMFS026F10+ TTTCAAAGAAACCTCGTATGTTTTGACATGACGAGCATCTTTGTTATCCTGGTAAAGAAC
JMSF025I23+ GGAAACCTCATATGTTTTGATATGACGAGCATCCTTGTTATCCTGGTAAAGAAC
JMSF033C17+ TTTCAAGGAAACCTCATATGTTTTGATATGACGAGCATCCTTGTTATCCTGGTAAAGAAC
JMFS130C08+ TATGACGAGCATCCTTGTTATCCTGGTAAAGAAC
                      ____________________________________________________________
consensus TTTCAAGGAAACCTCATATGTTTTGATATGACGAGCATCCTTGTTATCCTGGTAAAGAAC
 
. : . : . : . : . : . :
JMFS115G11+ AACAATTGTAGGCTTTGGGCAACCATACAAGAATTTTATATCCAAAACTTGAAGTTCCTC
JMFS091H10+ AACAATTGTAGGCTTTGGGCAACCATACAAGAATTTTATATCCAAAACTTGAAGTTCCTC
JMFS026F10+ TACAACAGTAGGCTTTGGACAACCATACAAGAATTTGATATCCAAAACTTGAAGTTCCTC
JMSF025I23+ AACAATTGTAGGCTTTGGGCAACCATACAAGAATTTTATATCCAAAACTTGAAGTTCNTC
JMSF033C17+ AACAATTGTAGGCTTTGGGCAACCATACAAGAATTTTATATCCAAAACTTGAAGTTCCTC
JMFS130C08+ AACAATTGTAGGCTTTGGGCAACCATACAAGAATTTTATATCCAAAACTTGAAGTTCCTC
JMFS042F04+ GTAGGCTTTGGGCAACCATACAAGAATTTTATATCCAAAACTGAAGTTTCNTC
                      ____________________________________________________________
consensus AACAATTGTAGGCTTTGGGCAACCATACAAGAATTTTATATCCAAAACTTGAAGTTCCTC
 
. : . : . : . : . : . :
JMFS115G11+ AAGCCTGATATTAAATGCTTCCTTAAGATGGCCCTTGTTATCAAAAGGTATA
JMFS091H10+ AAGCCTGATATTAAATGCTTCCTTAAGATGGCCCTTGTTATCAAAAGGTATAACCTTGAA
JMFS026F10+ GAGCCTGATGTTAAAAGCTTCCTTCAGCTGGCCTTTGTTATCAAATGGTATAACCTTGAA
JMSF025I23+ AAGCCTGATATTAAATGCTTCCTTAAGATGGCCCTTGTTATCAAAAGGTATAACCTTGAA
JMSF033C17+ AAGCCTGATATTAAATGCTTCCTTAAGATGGCCCTTGTTATCAAAAGGTATAACCTTGAA
JMFS130C08+ AAGCCTGATATTAAATGCTTCCTTAAGATGGCCCTTGTTATCAAAAGGTATAACCTTGAA
JMFS042F04+ AAGCCTGATATTAAATGCTTCCTTAAGATGGCCCTTGTTATCAAAAGGTATAACCTTGAA
                      ____________________________________________________________
consensus AAGCCTGATATTAAATGCTTCCTTAAGATGGCCCTTGTTATCAAAAGGTATAACCTTGAA
 
. : . : . : . : . : . :
JMFS091H10+ TAATCCATCATATAGATGAAGTCCAATCAATCTGCAATCTGGGTCAATTATGCCAATCTG
JMFS026F10+ TAATCCATCATATAGGTGAAGTCCAATTAATCTGCAATCTGGGTCAATTATGCCAATCTG
JMSF025I23+ TAATCCATCATATAGATGAAGTCCAATCAATCTGCAATCTGGGTCAATTATGCCAATCTG
JMSF033C17+ TAATCCATCATATAGATGAAGTCCAATCAATCTGCAATCTGGGTCAATTATGCCAATCTG
JMFS130C08+ TAATCCATCATATAGATGAAGTCCAATCAATCTGCAATCTGGGTCAATTATGCCAATCTG
JMFS042F04+ TAATCCATCATATAGATGAAGTCCAATCAATCTGCAATCTGGGTCAATTATGCCAATCTG
                      ____________________________________________________________
consensus TAATCCATCATATAGATGAAGTCCAATCAATCTGCAATCTGGGTCAATTATGCCAATCTG
 
. : . : . : . : . : . :
JMFS091H10+ CCCATTATCTGTGGGACGGCCGATTCGATCTGATACATCCCCCATTGATCTTGTA
JMFS026F10+ CCCATTATCTGTGGGACGGCCAATTCGATCAGAGACATCCCCCATCGCCCTCGTAATAAC
JMSF025I23+ CCCATTATCTGTGGGACGGCCGATTCGATCTGATACATCCCCCATTGATCTTGTAATAAC
JMSF033C17+ CCCATTATCTGTGGGACGGCCGATTCGATCTGATACATCCCCCATTGATCTTGTAATAAC
JMFS130C08+ CCCATTATCTGTGGGACGGCCGATTCGATCTGATACATCCCCCATTGATCTTGTAATAAC
JMFS042F04+ CCCATTATCTGTGGGACGGCCGATTCGATCTGATACATCCCCCATTGATCTTGTAATAAC
                      ____________________________________________________________
consensus CCCATTATCTGTGGGACGGCCGATTCGATCTGATACATCCCCCATTGATCTTGTAATAAC
 
. : . : . : . : . : . :
JMFS026F10+ CTCAGATATCTCTGCATCCCATTGAAGAACACAGAATTTGTATCTT
JMSF025I23+ CTNTGATGCCTCTGCATCCCATTGAAGAACACAGAATTTGTATCTTTCAGTTGCAATGAA
JMSF033C17+ CTCTGATGCCTCTGCATCCCATTGAAGAACACAGAATTTGTATCTTTCAGTTGCAATGAA
JMFS130C08+ CTCTGATGCCTCTGCATCCCATTGAAGAACACAGAATTTGTATCTTTCAGTTGCAATGAA
JMFS042F04+ CTCTGATGCCTCTGCATCCCATTGAAGAACACAGAATTTGTATCTTTCAGTTGCAATGAA
                      ____________________________________________________________
consensus CTCTGATGCCTCTGCATCCCATTGAAGAACACAGAATTTGTATCTTTCAGTTGCAATGAA
 
. : . : . : . : . : . :
JMSF025I23+ AAGAAGATCTTGTGTTTCACCATGTGGACGAAAAAGTTCAAGCGTAGCAATTCTTCCATA
JMSF033C17+ AAGAAGATCTTGTGTTTCACCATGTGGACGAAAAAGTTCAAGCGTAGCAATTCTTCCATA
JMFS130C08+ AAGAAGATCTTGTGTTTCACCATGTGGACGAAAAAGTTCAAGCGTAGCAATTCTTCCATA
JMFS042F04+ AAGAAGATCTTGTGTTTCACCATGTGGACGAAAAAGTTCAAGCGTAGCAATTCTTCCATA
                      ____________________________________________________________
consensus AAGAAGATCTTGTGTTTCACCATGTGGACGAAAAAGTTCAAGCGTAGCAATTCTTCCATA
 
. : . : . : . : . : . :
JMSF025I23+ TATTGGCACATCCAACATAGGCTGTAAACCTTGAGGAGTCAGTAAATGAATTTCGATGCG
JMSF033C17+ TATTGGCACATCCAACATAGGCTGTAAACCTTGAGGAGTCAGTAAATGAATTTCGATGCG
JMFS130C08+ TATTGGCACATCCAACATAGGCTGTAAACCTTGAGGAGTCAGTAAATGAATTTCGATGCG
JMFS042F04+ TATTGGCACATCCAACATAGGCTGTAAACCTTGAGGAGTCAGTAAATGAATTTCGATGCG
                      ____________________________________________________________
consensus TATTGGCACATCCAACATAGGCTGTAAACCTTGAGGAGTCAGTAAATGAATTTCGATGCG
 
. : . : . : . : . : . :
JMSF025I23+ AGTACATTTCGCAACGATGAGATTGAGCTCCTGCGGGCCGGTGAAATTGCCGACGCAAGA
JMSF033C17+ AGTACATTTCGCAACGATGAGATTGAGCTCCTGCGGGCCGGTGAAATTGCCGACGCAAGA
JMFS130C08+ AGTACATTTCGCAACGATGAGATTGAGCTCCTGCGGGCCGGTGAAATTGCCGACGCAAGA
JMFS042F04+ AGTACATTTCGCAACGATGAGATTGAGCTCCTGCGGGCCGGTGAAATTGCCGACGCAAGA
                      ____________________________________________________________
consensus AGTACATTTCGCAACGATGAGATTGAGCTCCTGCGGGCCGGTGAAATTGCCGACGCAAGA
 
. : . : . : . : . : . :
JMSF025I23+ ATGAGTAACGTTGGTCGGCTTGTGGGCAGTGACAACATAGTTCCACATACTCATCTCTC
JMSF033C17+ ATGAGTAACGTTGGTCGGCTTGTGGGCAGTGACAACATAGTTCCACATACTCATCTCTCA
JMFS130C08+ ATGAGTAACGTTGGTCGGCTTGTGGGCAGTGACAACATAGTTCCACATACTCATCTCTCA
JMFS042F04+ ATGAGTAACGTTGGTCGGCTTGTGGGCAGTGACAACATAGTTCCACATACTCATCTCTCA
                      ____________________________________________________________
consensus ATGAGTAACGTTGGTCGGCTTGTGGGCAGTGACAACATAGTTCCACATACTCATCTCTCA
 
. : . : . : . : . : . :
JMSF033C17+ GTAATGTAATGTGTGTGCGCCTTCGGAGAATTGGAGTGTCAATCAGAACTGAAACT
JMFS130C08+ GTAATGTAATGTGTGTGCGCCTTCGGAGAATTGGAGTGTCAATCAGAACTGAAACT
JMFS042F04+ GTAATGTAATGTGTGTGCGCCTTCGGAGAATTGGAGTGTCAATCAGAACTGAAACTGAAA
                      ____________________________________________________________
consensus GTAATGTAATGTGTGTGCGCCTTCGGAGAATTGGAGTGTCAATCAGAACTGAAACTGAAA