Previous Contig 003203:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS008E06Sequence614003203 (6)gb:AY495448_16089013e-65Arabidopsis thaliana clone AtGLR3.1 putative glutamate receptor ion channel (At2
JMFS026F06Sequence623003203 (6)pir|T51133|T511335e-47ligand gated channel-like protein [imported] - Arabidopsis thaliana>gb:AF038557_
JMFS042C11Sequence422003203 (6)gb:AF159498_17732375e-13Arabidopsis thaliana putative glutamate receptor like-protein (GLUR2) mRNA, comp
JMFS094F06Sequence642003203 (6)pir|T51133|T511335e-52ligand gated channel-like protein [imported] - Arabidopsis thaliana>gb:AF038557_
JMFS117B04Sequence615003203 (6)pir|T51133|T511332e-52ligand gated channel-like protein [imported] - Arabidopsis thaliana>gb:AF038557_
JMSF029E02Sequence681003203 (6)pir|T51133|T511332e-62ligand gated channel-like protein [imported] - Arabidopsis thaliana>gb:AF038557_737023378pir|T51131|T511313e-54ligand gated channel-like protein [imported] - rape>gb:AF109392_1768667 Brassica

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS008E06+ CGGAATCCGGTATGTAAGGCCGAAGCGTGAGGACCCCCTGCATGGTTTTGGCAACTCT
                      ____________________________________________________________
consensus CGGAATCCGGTATGTAAGGCCGAAGCGTGAGGACCCCCTGCATGGTTTTGGCAACTCT
 
. : . : . : . : . : . :
JMFS008E06+ AGTGGAAACTGGAGCTAAAGAAGAGTCCAAGAAAGTGGAAAGCCAAGAAGTGGCAATCCA
                      ____________________________________________________________
consensus AGTGGAAACTGGAGCTAAAGAAGAGTCCAAGAAAGTGGAAAGCCAAGAAGTGGCAATCCA
 
. : . : . : . : . : . :
JMFS008E06+ AACATATTCATCTGTCATCATCCCAAGATCCCTGGCCACTTCAAACACCAGAATACCCGT
                      ____________________________________________________________
consensus AACATATTCATCTGTCATCATCCCAAGATCCCTGGCCACTTCAAACACCAGAATACCCGT
 
. : . : . : . : . : . :
JMFS008E06+ TAAGGACAAGGTATGCACAACAATTACCCGGCACTCCATCAACCGCACCCGTATCAGTTC
                      ____________________________________________________________
consensus TAAGGACAAGGTATGCACAACAATTACCCGGCACTCCATCAACCGCACCCGTATCAGTTC
 
. : . : . : . : . : . :
JMFS008E06+ ATCCTTAATGTCCTGCCGAGTGGCCGAGGGGTCAGGTGGGAGTATCGCCCTGTAAGAAAT
JMSF029E02+ CCTGCCGAGTGGCCGAGGGGTCAGGTGGGAGTATCGCCCTGTAAGAAAT
                      ____________________________________________________________
consensus ATCCTTAATGTCCTGCCGAGTGGCCGAGGGGTCAGGTGGGAGTATCGCCCTGTAAGAAAT
 
. : . : . : . : . : . :
JMFS008E06+ CTTACAGCGCCTCTCGTAAAGCTTATCCCCCAGAGTGGCAATGCTATTCCGGCCTTGATC
JMSF029E02+ CTTACAGCGCCTCTCGTAAAGCTTATCCCCCAGAGTGGCAATGCTATTCCGGCCTTGATC
JMFS117B04+ TATTCCGGCCTTGATC
JMFS094F06+ TATTCCGGCCTTGATC
                      ____________________________________________________________
consensus CTTACAGCGCCTCTCGTAAAGCTTATCCCCCAGAGTGGCAATGCTATTCCGGCCTTGATC
 
. : . : . : . : . : . :
JMFS008E06+ GTCGTCGGAGAAGACAGCGGTCACCTCACTATACCCAAAATAGCTAACCATATCCGCCAC
JMSF029E02+ GTCGTCGGAGAAGACAGCGGTCACCTCACTATACCCAAAATAGCTAACCATATCCGCCAC
JMFS117B04+ GTCGTCGGAGAAGACAGCGGTCACCTCACTATACCCAAAATAGCTAACCATATCCGCCAC
JMFS094F06+ GTCGTCGGAGAAGACAGCGGTCACCTCACTATACCCAAAATAGCTAACCATATCCGCCAC
JMFS026F06+ ACTATACCCAAAATAGCTAACCATATCCGCCAC
                      ____________________________________________________________
consensus GTCGTCGGAGAAGACAGCGGTCACCTCACTATACCCAAAATAGCTAACCATATCCGCCAC
 
. : . : . : . : . : . :
JMFS008E06+ GGCGGTCATGAGGAACAGATCATTGGGCGCAGTTTGAATGAAATAGGGATACTGGAGAGG
JMSF029E02+ GGCGGTCATGAGGAACAGATCATTGGGCGCAGTTTGAATGAAATAGGGATACTGGAGAGG
JMFS117B04+ GGCGGTCATGAGGAACAGATCATTGGGCGCAGTTTGAATGAAATAGGGATACTGGAGAGG
JMFS094F06+ GGCGGTCATGAGGAACAGATCATTGGGCGCAGTTTGAATGAAATAGGGATACTGGAGAGG
JMFS026F06+ GGCGGTCATGAGGAACAGATCATTGGGCGCAGTTTGAATGAAATAGGGATACTGGAGAGG
                      ____________________________________________________________
consensus GGCGGTCATGAGGAACAGATCATTGGGCGCAGTTTGAATGAAATAGGGATACTGGAGAGG
 
. : . : . : . : . : . :
JMFS008E06+ GGAGAGAGTGGGATCCAAGGCCGTGAAGGATAGAAATGGGACATGGAGTTCGTTTGCGAA
JMSF029E02+ GGAGAGAGTGGGATCCAAGGCCGTGAAGGATAGAAATGGGACATGGAGTTCGTTTGCGAA
JMFS117B04+ GGAGAGAGTGGGATCCAAGGCCGTGAAGGATAGAAATGGGACATGGAGTTCGTTTGCGAA
JMFS094F06+ GGAGAGAGTGGGATCCAAGGCCGTGAAGGATAGAAATGGGACATGGAGTTCGTTTGCGAA
JMFS026F06+ GGAGAGAGTGGGATCCAAGGCCGTGAAGGATAGAAATGGGACATGGAGTTCGTTTGCGAA
                      ____________________________________________________________
consensus GGAGAGAGTGGGATCCAAGGCCGTGAAGGATAGAAATGGGACATGGAGTTCGTTTGCGAA
 
. : . : . : . : . : . :
JMFS008E06+ GTGGGAAAGCACATGGGCCATTACAGAACTTTGGGGGCCAATGATAGCTACGGTATCAGT
JMSF029E02+ GTGGGAAAGCACATGGGCCATTACAGAACTTTGGGGGCCAATGATAGCTACGGTATCAGT
JMFS117B04+ GTGGGAAAGCACATGGGCCATTACAGAACTTTGGGGGCCAATGATAGCTACGGTATCAGT
JMFS094F06+ GTGGGAAAGCACATGGGCCATTACAGAACTTTGGGGGCCAATGATAGCTACGGTATCAGT
JMFS026F06+ GTGGGAAAGCACATGGGCCATTACAGAACTTTGGGGGCCAATGATAGCTACGGTATCAGT
JMFS042C11+ GT
                      ____________________________________________________________
consensus GTGGGAAAGCACATGGGCCATTACAGAACTTTGGGGGCCAATGATAGCTACGGTATCAGT
 
. : . : . : . : . : . :
JMFS008E06+ CTCCAGGAACTTCATT
JMSF029E02+ CTCCAGGAACTTCATTGCTCCCACAATTCCCAGGAATCCGCTGTAATTTGAATCGTGCAT
JMFS117B04+ CTCCAGGAACTTCATTGCTCCCACAATTCCCAGGAATCCGCTGTAATTTGAATCGTGCAT
JMFS094F06+ CTCCAGGAACTTCATTGCTCCCACAATTCCCAGGAATCCGCTGTAATTTGAATCGTGCAT
JMFS026F06+ CTCCAGGAACTTCATTGCTCCCACAATTCCCAGGAATCCGCTGTAATTTGAATCGTGCAT
JMFS042C11+ CTCCAGGAACTTCATTGCTCCCGCAATTCCCAGGAATCCGCTGTAATTTGAATCGTGCAT
                      ____________________________________________________________
consensus CTCCAGGAACTTCATTGCTCCCACAATTCCCAGGAATCCGCTGTAATTTGAATCGTGCAT
 
. : . : . : . : . : . :
JMSF029E02+ ATAGAGATTGAGCTTTCTTCCGCCAAGGATAGTGGGATCAGAATTGATATCTACCACTGC
JMFS117B04+ ATAGAGATTGAGCTTTCTTCCGCCAAGGATAGTGGGATCAGAATTGATATCTACCACTGC
JMFS094F06+ ATAGAGATTGAGCTTTCTTCCGCCAAGGATAGTGGGATCAGAATTGATATCTACCACTGC
JMFS026F06+ ATAGAGATTGAGCTTTCTTCCGCCAAGGATAGTGGGATCAGAATTGATATCTACCACTGC
JMFS042C11+ ATAGAGATTGAGCTTTCTTCCGCCAAGGATAGTGGGATCAGAATTGATATCTACCACTGC
                      ____________________________________________________________
consensus ATAGAGATTGAGCTTTCTTCCGCCAAGGATAGTGGGATCAGAATTGATATCTACCACTGC
 
. : . : . : . : . : . :
JMSF029E02+ AGCAGACATTGCAATTCTTGCTACTTGCCCATTAGTTGTCCCAAATGAAAAAATGGCTCC
JMFS117B04+ AGCAGACATTGCAATTCTTGCTACTTGCCCATTAGTTGTCCCAAATGAAAAAATGGCTCC
JMFS094F06+ AGCAGACATTGCAATTCTTGCTACTTGCCCATTAGTTGTCCCAAATGAAAAAATGGCTCC
JMFS026F06+ AGCAGACATTGCAATTCTTGCTACTTGCCCATTAGTTGTCCCAAATGAAAAAATGGCTCC
JMFS042C11+ AGCAGACATTGCAATTCTTGCTACTTGCCCATTAGTTGTCCCAAATGAAAAAATGGCTCC
                      ____________________________________________________________
consensus AGCAGACATTGCAATTCTTGCTACTTGCCCATTAGTTGTCCCAAATGAAAAAATGGCTCC
 
. : . : . : . : . : . :
JMSF029E02+ AATGTTCACATCATCATCATTATCTTCTCTGCAAATTACCCTTCCAATAAGGAGGAGAGA
JMFS117B04+ AATGTTCACATCATCATCATTATCTTCTCTGCAAATTACCCTTCCAATAAGGAGGAGAGA
JMFS094F06+ AATGTTCACATCATCATCATTATCTTCTCTGCAAATTACCCTTCCAATAAGGAGGAGAGA
JMFS026F06+ AATGTTCACATCATCATCATTATCTTCTCTGCAAATTACCCTTCCAATAAGGAGGAGAGA
JMFS042C11+ AATGTTCACATCATCATCATTATCTTCTCTGCAAATTCCCCTTCCAATAAGGAGGAGAGA
                      ____________________________________________________________
consensus AATGTTCACATCATCATCATTATCTTCTCTGCAAATTACCCTTCCAATAAGGAGGAGAGA
 
. : . : . : . : . : . :
JMSF029E02+ TGTCACA-ACTATCCA-AGGGATAATATCCATTGCATAGTACGTAATTTCCAGGAATTGA
JMFS117B04+ TGTCACA-ACTATCCA-AGGGATAATATCCATTGCATAGTACGTAATTTCCAGGAATTGA
JMFS094F06+ TGTCACA-ACTATCCA-AGGGATAATATCCATTGCATAGTACGTAATTTCCAGGAATTGA
JMFS026F06+ TGTCACA-ACTATCCA-AGGGATAATATCCATTGCATAGTACGTAATTTCCAGGAATTGA
JMFS042C11+ TGTCACAGACTATCCAGAGGGATAATATCCATTGCATAGTACGTAATTTCCAGGAATTGA
                      ____________________________________________________________
consensus TGTCACA-ACTATCCA-AGGGATAATATCCATTGCATAGTACGTAATTTCCAGGAATTGA
 
. : . : . : . : . : . :
JMSF029E02+ TCCAAGCTAAGAGGTATAGTAGAAAGAAAACTT
JMFS117B04+ TCCAAGCTAAGAGGTATAGTAGAAAGAAAACTTGTTTCTATGGGAAAGAATGTCA
JMFS094F06+ TCCAAGCTAAGAGGTATAGTAGAAAGAAAACTTGTTTCTATGGGAAAGAATGTCAGCAAT
JMFS026F06+ TCCAAGCTAAGAGGTATAGTAGAAAGAAAACTTGTTTCTATGGGAAAGAATGTCAGCAAT
JMFS042C11+ TCCAAGCTAAGAGGTATAGTAGAAAGAAAACTTGTTTCTATGGGAAAGAATGTCAGCAAT
                      ____________________________________________________________
consensus TCCAAGCTAAGAGGTATAGTAGAAAGAAAACTTGTTTCTATGGGAAAGAATGTCAGCAAT
 
. : . : . : . : . : . :
JMFS094F06+ GAAGCCCAAGTGGAG-ACGACGACACAAG
JMFS026F06+ GAAGCCCAAGTGGAG-ACGACGACACAAGCTAGCCTGGAAGAAAAGAATGGTC
JMFS042C11+ CAAGCCCAAGTGGAGCACGACGACACAAGCTAGCCTGGAAGAAAAGCATGGTCGTCGTCA
                      ____________________________________________________________
consensus GAAGCCCAAGTGGAG-ACGACGACACAAGCTAGCCTGGAAGAAAAGCATGGTCGTCGTCA