Previous Contig 003199:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004C01Sequence500003199 (10)pir|T48442|T484420.005hypothetical protein T32M21.60 - Arabidopsis thaliana>gb:ATT32M21_1555912 Arabid800008310 (3)gb:AP004026_18365567e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMFS026C01Sequence607003199 (10)pir|H84678|H846787e-26hypothetical protein At2g27950 [imported] - Arabidopsis thaliana>gb:AC006929_153
JMFS041C02Sequence659003199 (10)pir|T48442|T484420.003hypothetical protein T32M21.60 - Arabidopsis thaliana>gb:ATT32M21_1555912 Arabid
JMFS084A07Sequence611003199 (10)pir|T48442|T484423e-17hypothetical protein T32M21.60 - Arabidopsis thaliana>gb:ATT32M21_1555912 Arabid
JMFS119B04Sequence619003199 (10)pir|T48442|T484427e-18hypothetical protein T32M21.60 - Arabidopsis thaliana>gb:ATT32M21_1555912 Arabid
JMFS121B11Sequence572003199 (10)pir|T48442|T484429e-21hypothetical protein T32M21.60 - Arabidopsis thaliana>gb:ATT32M21_1555912 Arabid
JMFS150B04Sequence447003199 (10)pir|T48442|T484421e-13hypothetical protein T32M21.60 - Arabidopsis thaliana>gb:ATT32M21_1555912 Arabid
JMFS150B05Sequence506003199 (10)pir|T48442|T484423e-15hypothetical protein T32M21.60 - Arabidopsis thaliana>gb:ATT32M21_1555912 Arabid
JMSF015E03Sequence213003199 (10)729008310 (3)gb:AP004026_18365561e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMSF034B08Sequence150003199 (10)738008310 (3)gb:AP004026_18365569e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS026C01+ GCAGCAAGCTTATCTTGGTAATAGCATTCA
                      ____________________________________________________________
consensus GCAGCAAGCTTATCTTGGTAATAGCATTCA
 
. : . : . : . : . : . :
JMFS026C01+ TCTATGACATCCGGACCATTGTTTGATTGAGACTCGATAGTTTCAAAATCATCATGGTCA
                      ____________________________________________________________
consensus TCTATGACATCCGGACCATTGTTTGATTGAGACTCGATAGTTTCAAAATCATCATGGTCA
 
. : . : . : . : . : . :
JMFS026C01+ GCATTGGGACAGCCATTGGACTGGCTACTGTTGACTTGACAATTACTGCCATCATCCAAT
                      ____________________________________________________________
consensus GCATTGGGACAGCCATTGGACTGGCTACTGTTGACTTGACAATTACTGCCATCATCCAAT
 
. : . : . : . : . : . :
JMFS026C01+ TTAGACAAAAATCCTTCCCTCAAATCAGATACAGTTTGTCTTTGCCTCAGTACACCCAAT
                      ____________________________________________________________
consensus TTAGACAAAAATCCTTCCCTCAAATCAGATACAGTTTGTCTTTGCCTCAGTACACCCAAT
 
. : . : . : . : . : . :
JMFS026C01+ TCACTTGCCGCAACTGAGGCAGGTTTTTCATCAAGAATCGATCTCTCATTTCGCAAGAAT
                      ____________________________________________________________
consensus TCACTTGCCGCAACTGAGGCAGGTTTTTCATCAAGAATCGATCTCTCATTTCGCAAGAAT
 
. : . : . : . : . : . :
JMFS026C01+ CTGCCTCTAAGTAATGACTGGATGCGATTGCGATAAGCGAAGTCTGAAACAGGTTTACGC
                      ____________________________________________________________
consensus CTGCCTCTAAGTAATGACTGGATGCGATTGCGATAAGCGAAGTCTGAAACAGGTTTACGC
 
. : . : . : . : . : . :
JMFS026C01+ TCCATCAACCATTGAAGTTCTTTTTTCCTTTGCCTCTGAGCCTTCAGCAGCAAATCGAGA
                      ____________________________________________________________
consensus TCCATCAACCATTGAAGTTCTTTTTTCCTTTGCCTCTGAGCCTTCAGCAGCAAATCGAGA
 
. : . : . : . : . : . :
JMFS026C01+ AGAGCCTGTCTGCCACAAAGTCTACGTAAGCCTCTTCGTTCTCCAGTTTCAGAGCGGTTG
                      ____________________________________________________________
consensus AGAGCCTGTCTGCCACAAAGTCTACGTAAGCCTCTTCGTTCTCCAGTTTCAGAGCGGTTG
 
. : . : . : . : . : . :
JMFS026C01+ ACAGGCATCCCATCACGCACTTGTTCAATTTGTGAGCCGATTTCAGCACACCTTTCGTCT
                      ____________________________________________________________
consensus ACAGGCATCCCATCACGCACTTGTTCAATTTGTGAGCCGATTTCAGCACACCTTTCGTCT
 
. : . : . : . : . : . :
JMFS026C01+ CTATGTGAAGCATTTGTGCCTCTCTGCTGAATATTCAGTTGGACCCACTCCCTTACAACT
JMFS121B11+ AAGCATTTGTGCCTCTCTGCTGAATATTCAGTTGGACCCACTCCCTTACAACT
                      ____________________________________________________________
consensus CTATGTGAAGCATTTGTGCCTCTCTGCTGAATATTCAGTTGGACCCACTCCCTTACAACT
 
. : . : . : . : . : . :
JMFS026C01+ CTCACTCGTTCACATTCGTTTTCACCCAACCACTCCG
JMFS121B11+ CTCACTCGTTCACATTCGTTTTCACCCAACCACTCCGCCGCCCTAGACTGGTTATTGATA
JMFS119B04+ CACATTCGTTTTCACCCAACCACTCCGCCGCCCTAGACTGGTTATTGATA
JMFS150B05+ TCACCCAACCACTCCGCCGCCCTAGGCTGGTTATTGATA
JMFS084A07+ TCACCCAACCACTCCGCCGCCCTAGACTGGTTATTGATA
                      ____________________________________________________________
consensus CTCACTCGTTCACATTCGTTTTCACCCAACCACTCCGCCGCCCTAGACTGGTTATTGATA
 
. : . : . : . : . : . :
JMFS121B11+ TGTATGGTGTTGTTCATCGAATGGCTCTTTACGCCACCATTGTTTTTCCATTCCTTGAAA
JMFS119B04+ TGTATGGTGTTGTTCATCGAATGGCTCTTTACGCCACCATTGTTTTTCCATTCCTTGAAA
JMFS150B05+ TGTAGGGGNGTGTTCATCGAATGGCTCTTTACGCGGCCATTGTTTTTGCGTTGCGTGAGA
JMFS150B04+ ATGGCTCTTTAGGCCNCCATTGTTTTTCCATTCCTTGAAA
JMFS084A07+ TGTATGGTGTTGTTCATCGAATGGCTCTTTACGCCACCATTGTTTTTCCATTCCTTGAAA
                      ____________________________________________________________
consensus TGTATGGTGTTGTTCATCGAATGGCTCTTTACGCCACCATTGTTTTTCCATTCCTTGAAA
 
. : . : . : . : . : . :
JMFS121B11+ ACTTGCCTTACTCTTTCCCTTTCGATCTCCGTAAAATCAGTGGACTGGTCCGAGACGACA
JMFS119B04+ ACTTGCCTTACTCTTTCCCTTTCGATCTCCGTAAAATCAGTGGACTGGTCCGAGACGACA
JMFS150B05+ ACTTGCGNTACTCTTTCCCTTTCGATCTCCGTAAAATCAGTGGACTGGTCCGAGNCGACA
JMFS150B04+ ACTTGCCTTACTCTTTCCCCTTCGATCTCCGTAAAATCAGTGGACTGGTCCGAGNCGACA
JMSF034B08+ TCCGTAAAATCAGTGGACTGGTCCGAGACGACA
JMFS084A07+ ACTTGCCTTACTCTTTCCCTTTCGATCTCCGTAAAATCAGTGGACTGGTCCGAGACGACA
                      ____________________________________________________________
consensus ACTTGCCTTACTCTTTCCCTTTCGATCTCCGTAAAATCAGTGGACTGGTCCGAGACGACA
 
. : . : . : . : . : . :
JMFS121B11+ CTCGTGCCATCATGATGCTCATTCTCCAACACTATCTGCTCATATGCCCCGTATTCGTTC
JMFS119B04+ CTCGTGCCATCATGATGCTCATTCTCCAACACTATCTGCTCATATGCCCCGTATTCGTTC
JMFS150B05+ CTCGTGCCATCATGATGCTCATTCTCCAACACTATCTGCTCATATGCCCCGTATTCGTTC
JMFS150B04+ CTCGTGCCATCATGATGCTCATTCTCCAACACTATCTGCTCATATGCCCCGTATTCGTTC
JMSF034B08+ CTCGTGCCATCATGATGCTCATTCTCCAACACTATCTGCTCATATGCCCCGTATTCGTTC
JMFS084A07+ CTCGTGCCATCATGATGCTCATTCTCCAACACTATCTGCTCATATGCCCCGTATTCGTTC
                      ____________________________________________________________
consensus CTCGTGCCATCATGATGCTCATTCTCCAACACTATCTGCTCATATGCCCCGTATTCGTTC
 
. : . : . : . : . : . :
JMFS121B11+ TCAGTCTCATTAGCATCCTCCACACTATCATTCCCATTGACGCTTCCCTGCCCATCTAAC
JMFS119B04+ TCAGTCTCATTAGCATCCTCCACACTATCATTCCCATTGACGCTTCCCTGCCCATCTAAC
JMFS150B05+ TCAGTCTCATTAGCATCCTCCACACTATCATTCCCATTGACGCTTCCCTGCCCATCTAAC
JMFS150B04+ TCAGTCTCATTAGCATCCTCCACACTATCATTCCCATTGACGCTTCCCTGCCCATCTAAC
JMSF034B08+ TCAGTCTCATTAGCATCCTCCACACTATCATTCCCATTGACGCTTCCCTGCCCATCT
JMFS084A07+ TCAGTCTCATTAGCATCCTCCACACTATCATTCCCATTGACGCTTCCCTGCCCATCTAAC
JMFS041C02+ C
                      ____________________________________________________________
consensus TCAGTCTCATTAGCATCCTCCACACTATCATTCCCATTGACGCTTCCCTGCCCATCTAAC
 
. : . : . : . : . : . :
JMFS121B11+ TCAAAACTGATTACAGAATCCGGATTTGACCCCTCACTCCTCAACTGCCCATCTCTATCT
JMFS119B04+ TCAAAACTGATTACAGAATCCGGATTTGACCCCTCACTCCTCAACTGCCCATCTCTATCT
JMFS150B05+ TCAAAACTGATTACAGAATCCGGATTTGACCCCTCACTCCTCAACTGCCCATCTCTATAT
JMFS150B04+ TCAAAACTGATTACAGAATCCGGATTTGACCCCTCACTCCTCAACTGCCCATCTCTATAT
JMFS084A07+ TCAAAACTGATTACAGAATCCGGATTTGACCCCTCACTCCTCAACTGCCCATCTCTATCT
JMFF004C01+ TTTGACCCCTCACTCCTCAACTGCCCATCTCTATCT
JMFS041C02+ TCAAAACTGATTACAGAATCCGGATTTGACCCCTCACTCCTCAACTGCCCATCTCTATCT
                      ____________________________________________________________
consensus TCAAAACTGATTACAGAATCCGGATTTGACCCCTCACTCCTCAACTGCCCATCTCTATCT
 
. : . : . : . : . : . :
JMFS121B11+ ACATATCTGGCAACGGGATTACTCACAACACGCTCACCCTCGAGCTCCCGCCACATTTGC
JMFS119B04+ ACATATCTGGCAACGGGATTACTCACAACACGCTCACCCTCGAGCTCCCGCCACATTTGC
JMFS150B05+ ACATATCTGGCAACGGGATTACTCACAACACGCTCACCCTCGAGCTCCCGCCACATTTGC
JMFS150B04+ ACATATCTGGCAACGGGATTACTCACAACACGCTCACCCTCGAGCTCCCGCCACATTTGC
JMFS084A07+ ACATATCTGGCAACGGGATTACTCACAACACGCTCACCCTCGAGCTCCCGCCACATTTGC
JMFF004C01+ ACATATCTGGCANCGGGATTACTCACAACACGCTCACCCTCGAGCTCCCGCCACATTTGC
JMFS041C02+ ACATATCTGGCAACGGGATTACTCACAACACGCTCACCCTCGAGCTCCCGCCACATTTGC
                      ____________________________________________________________
consensus ACATATCTGGCAACGGGATTACTCACAACACGCTCACCCTCGAGCTCCCGCCACATTTGC
 
. : . : . : . : . : . :
JMFS121B11+ AGGATAGTGGATGCCTGTGTGCTTGGCATTTCTTGCTCACCCCATCTCCCCGATATCGAA
JMFS119B04+ AGGATAGTGGATGCCTGTGTGCTTGGCATTTCTTGCTCACCCCATCTCCCCGATATCGAA
JMFS150B05+ AGGATAGTGGATGCCTGTGTGCTTGGCATTTCTTGCTCACCCCATCTCCCCGATATCGAA
JMFS150B04+ AGGATAGTGGATGCCTGTGTGCTTGGCATTTCTTGCTCACCCCATCTCCCCGATATCGAA
JMFS084A07+ AGGATAGTGGATGCCTGTGTGCTTGGCATTTCTTGCTCACCCCATCTCCCCGATATCGAA
JMFF004C01+ AGGATAGTGGATGCCTGTGTGCTTGGCATTTCTTGCTCACCCCATCTCCCCGATATCGAA
JMFS041C02+ AGGATAGTGGATGCCTGTGTGCTTGGCATTTCTTGCTCACCCCATCTCCCCGATATCGAA
                      ____________________________________________________________
consensus AGGATAGTGGATGCCTGTGTGCTTGGCATTTCTTGCTCACCCCATCTCCCCGATATCGAA
 
. : . : . : . : . : . :
JMFS121B11+ GACT
JMFS119B04+ GACTAGATCTAAGTAGACCTCCAATCTGCTTAGAATCCCTCTAGAAAATATCTTTAATAT
JMFS150B05+ GACTAGATCTAAGTAGACCTCCAATCTGCTTAGAATCCCTCTAGAAA
JMFS150B04+ GACTAGATCTAAGTAGACCTCCAATCTGCTTAGAATCCCTCTAGAAA
JMFS084A07+ GACTAGATCTAAGTAGACCTCCAATCTGCTTAGAATCCCTCTAGAAAATATCTTTAATAT
JMFF004C01+ GACTAGATCTAAGTAGACCTCCAATCTGCTTAGAATCCCTCTAGAAAATATCTTTAATAT
JMFS041C02+ GACTAGATCTAAGTAGACCTCCAATCTGCTTAGAATCCCTCTAGAAAATATCTTTAATAT
                      ____________________________________________________________
consensus GACTAGATCTAAGTAGACCTCCAATCTGCTTAGAATCCCTCTAGAAAATATCTTTAATAT
 
. : . : . : . : . : . :
JMFS119B04+ CTTTTGACAGCTATGGTTCTTCGCCTCCAGGCTCAAGCACCAACCCAGCACATAGAGAGA
JMFS084A07+ CTTTTGACAGCTATGGTTCTTCGCCTCCAGGCTCAAGCACCAACCCAGCACATAGAGAGA
JMSF015E03+ TCCAGGCTCAAGCACCAACCCAGCACATAGAGAGA
JMFF004C01+ CTTTTGACAGCTATGGTTCTTCGCCTCCAGGCTCAAGCACCAACCCAGCACATAGAGAGA
JMFS041C02+ CTTTTGACAGCTATGGTTCTTCGCCTCCAGGCTCAAGCACCAACCCAGCACATA--GAGA
                      ____________________________________________________________
consensus CTTTTGACAGCTATGGTTCTTCGCCTCCAGGCTCAAGCACCAACCCAGCACATAGAGAGA
 
. : . : . : . : . : . :
JMFS119B04+ GAGAGAGAGAGAGAGAATTTAAGAGAAAT
JMFS084A07+ GAGAGAGAGAGAGAGAATTTAAGAGAAAT
JMSF015E03+ GAGAGAGAGAGAGAGAATTTAAGAGAAATAAAAATGAGAGAGGGGACACGTCAACGTTTG
JMFF004C01+ GAGAGAGAGAGAGAGAATTTAAGAGAAATAAAAATGAGAGAGGGGACACGTCAACGTTTG
JMFS041C02+ GAGAGAGAGAGAGAGAATTTAAGAGAAATAAAAATGAGAGAGGGGACACGTCAACGTTTG
                      ____________________________________________________________
consensus GAGAGAGAGAGAGAGAATTTAAGAGAAATAAAAATGAGAGAGGGGACACGTCAACGTTTG
 
. : . : . : . : . : . :
JMSF015E03+ CTCGATCTATTGTTTTATATATTTAAAGATTGACGGAAATTTTGCCGTGACTCTAACGTC
JMFF004C01+ CTCGATCTATTGTTTTATATATTTAAAGATTGACGGAAATTTTGCCGTGACTCTAACGTC
JMFS041C02+ CTCGATCTATTGTTTTATATATTTAAAGATTGACGGAAATTTTGCCGTGACTCTAACGTC
                      ____________________________________________________________
consensus CTCGATCTATTGTTTTATATATTTAAAGATTGACGGAAATTTTGCCGTGACTCTAACGTC
 
. : . : . : . : . : . :
JMSF015E03+ TAATTGTACCGGCGAAGGGGGGATGTGAGTGTCGTTCTCCGGACGGTGAGGTT
JMFF004C01+ TAATTGTACCGGCGAAGGGGGGATGTGAGTGTCGTTCTCCGGACGGTGAGGTTAGGAAAC
JMFS041C02+ TAATTGTACCGGCGAAGGGGGGATGTGAGTGTCGTTCTCCGGACGGTGAGGTTAGGAAAC
                      ____________________________________________________________
consensus TAATTGTACCGGCGAAGGGGGGATGTGAGTGTCGTTCTCCGGACGGTGAGGTTAGGAAAC
 
. : . : . : . : . : . :
JMFF004C01+ TTCCGCCACACAAGTCTTGAATTTAACGGTAAGCTGTTGCGCGC
JMFS041C02+ TTCCGCCACACAAGTCTTGAATTTAACGGTAAGCTGTTGTGCGCCACTATTATGGTGAGC
                      ____________________________________________________________
consensus TTCCGCCACACAAGTCTTGAATTTAACGGTAAGCTGTTGTGCGCCACTATTATGGTGAGC
 
. : . : . : . : . : . :
JMFS041C02+ CTCCACGGTAACTTATAGTGCTCAGTCGAGGGACTTGAGACACGTTTGGCTCTACTTAAA
                      ____________________________________________________________
consensus CTCCACGGTAACTTATAGTGCTCAGTCGAGGGACTTGAGACACGTTTGGCTCTACTTAAA
 
. : . : . : . : . : . :
JMFS041C02+ TACCCTCACAATGCCTACTACGACTCAATACTCATCCTCAAAATAGAATTGTATTGTTTT
                      ____________________________________________________________
consensus TACCCTCACAATGCCTACTACGACTCAATACTCATCCTCAAAATAGAATTGTATTGTTTT