Previous Contig 003196:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS041A03Sequence630003196 (6)gb:AY120767_15796493e-70Arabidopsis thaliana xylosidase (At5g49360) mRNA, complete cds.
JMFS045A04Sequence554003196 (6)gb:AY120767_15796493e-40Arabidopsis thaliana xylosidase (At5g49360) mRNA, complete cds.
JMFS052D05Sequence613003196 (6)gb:AY120767_15796493e-69Arabidopsis thaliana xylosidase (At5g49360) mRNA, complete cds.
JMFS060F07Sequence620003196 (6)gb:AY120767_15796493e-70Arabidopsis thaliana xylosidase (At5g49360) mRNA, complete cds.
JMFS104A11Sequence627003196 (6)gb:AY120767_15796498e-73Arabidopsis thaliana xylosidase (At5g49360) mRNA, complete cds.
JMFS118B10Sequence627003196 (6)gb:AY120767_15796492e-83Arabidopsis thaliana xylosidase (At5g49360) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS118B10+ TCATAAGCAGTATAGTGCTTGCAACAAGCAGCAAGTTTCAAGTGGTTATTGG
                      ____________________________________________________________
consensus TCATAAGCAGTATAGTGCTTGCAACAAGCAGCAAGTTTCAAGTGGTTATTGG
 
. : . : . : . : . : . :
JMFS118B10+ GATTGGCTCCACCTTGTAGACCTTTTACATAGCTAACTGCATATTGGGCCACCACGTGAG
JMFS104A11+ TAGACCTTTTACATAGCTAACTGCATATTGGGCCACCACGTGAG
JMFS060F07+ GCATATTGGGCCACCACGTGAG
JMFS052D05+ TAACTGCATA-TGGGCCACCACGTGAG
JMFS045A04+ GCTAACTGCATATTGGGCCACCACGTGAG
JMFS041A03+ GCTAACTGCATATTGGGCCACCACGTGAG
                      ____________________________________________________________
consensus GATTGGCTCCACCTTGTAGACCTTTTACATAGCTAACTGCATATTGGGCCACCACGTGAG
 
. : . : . : . : . : . :
JMFS118B10+ GGTCCTCCCCCGGTGTCTCTTGGCTTCTCCCCCACCTTGGGTCTCTCAATACGTTCACGT
JMFS104A11+ GGTCCTCCCCCGGTGTCTCTTGGCTTCTCCCCCACCTTGGGTCTCTCAATACGTTCACGT
JMFS060F07+ GGTCCTCCCCCGGTGTCTCTTGGCTTCTCCCCCACCTTGGGTCTCTCAATACGTTCACGT
JMFS052D05+ GGTCCTCCCCCGGTGTCTCTTGGCTTCTCCCCCACCTTGGGTCTCTCAATACGTTCACGT
JMFS045A04+ GGTCCTCCNCCGGTGTCTCTTGGCTTCTCCNCCACCTTGNGTCTCTCAATACGTTCACGT
JMFS041A03+ GGTCCTCCNCCGGTGTCTCTTGGCTTCTCCCCCACCTTGGGTCTCTCAATACGTTCACGT
                      ____________________________________________________________
consensus GGTCCTCCCCCGGTGTCTCTTGGCTTCTCCCCCACCTTGGGTCTCTCAATACGTTCACGT
 
. : . : . : . : . : . :
JMFS118B10+ TTGGGCTCCAAAATGTTAGCCCTGCTGCCCCTCCATTGTACATTGCTCTTGCTTCATCCG
JMFS104A11+ TTGGGCTCCAAAATGTTAGCCCTGCTGCCCCTCTATTGTACATTGCTCTTGCTTCATCCG
JMFS060F07+ TTGGGCTCCAAAATGTTAGCCCTGCTGCCCCTCCATTGTACATTGCTCTTGCTTCATCCG
JMFS052D05+ TTGGGCTCCAAAATGTTAGCCCTGCTGCCCCTCCATTGTACATTGCTCTTGCTTCATCCG
JMFS045A04+ TT-GGCTCCAAAATGTTAGCCCTGCTGCCCCTCCATTGTACATTGCTCTTGCTTCATCCG
JMFS041A03+ TTGGGCTCCAAAATGTTAGCCCTGCTGCCCCTCCATTGTACATTGCTCTTGCTTCATCCG
                      ____________________________________________________________
consensus TTGGGCTCCAAAATGTTAGCCCTGCTGCCCCTCCATTGTACATTGCTCTTGCTTCATCCG
 
. : . : . : . : . : . :
JMFS118B10+ ACACCACACGTCCAATTGCCTCCCACAAGGAGGAGTTGAAAGCGGCGGCGGAGGTGATGA
JMFS104A11+ ACACCACACGTCCAATTGCCTCCCACAAGGAGGAGTTGAAAGCGGCGGCGGAGGTGATGA
JMFS060F07+ ACACCACACGTCCAATTGCCTCCCACAAGGAGGAGTTGAAAGCGGCGGCGGAGGTGATGA
JMFS052D05+ ACACCACACGTCCAATTGCCTCCCACAAGGAGGAGTTGAAAGCGGCGGCGGAGGTGATGA
JMFS045A04+ ACACCACACGTCCAATTGCCTCCCACAAGGAGGAGTTGAAAGCGGCGGCGGAGGTGATGA
JMFS041A03+ ACACCACACGTCCAATTGCCTCCCACAAGGAGGAGTTGAAAGCGGCGGCGGAGGTGATGA
                      ____________________________________________________________
consensus ACACCACACGTCCAATTGCCTCCCACAAGGAGGAGTTGAAAGCGGCGGCGGAGGTGATGA
 
. : . : . : . : . : . :
JMFS118B10+ CTTGAGGGAAGCTGGTGGCGCCCGGGAAGGCGCCGCCGAATCTGGTGCCGGGGCCGACGT
JMFS104A11+ CTTGAGGGAAGCTGGTGGCGCCCGGGAAGGCGCCGCCGAATCTGGTGCCGGGGCCGACGT
JMFS060F07+ CTTGAGGGAAGCTGGTGGCGCCCGGGAAGGCGCCGCCGAATCTGGTGCCGGGGCCGACGT
JMFS052D05+ CTTGAGGGAAGCTGGTGGCGCCCGGGAAGGCGCCGCCGAATCTGGTGCCGGGGCCGACGT
JMFS045A04+ CTTGAGGGAAGCTGGTGGCGCCCGGGAAGGCGCCGCCGAATCTGGTGCCGGGGCCGACGT
JMFS041A03+ CTTGAGGGAAGCTGGTGGCGCCCGGGAAGGCGCCGCCGAATCTGGTGCCGGGGCCGACGT
                      ____________________________________________________________
consensus CTTGAGGGAAGCTGGTGGCGCCCGGGAAGGCGCCGCCGAATCTGGTGCCGGGGCCGACGT
 
. : . : . : . : . : . :
JMFS118B10+ TTGAGACGCCGTGCAGCGCCTCGTTCCACCACTCGTAGCGCATGATGCCTAGCCGCTCCA
JMFS104A11+ TTGAGACGCCGTGCAGCGCCTCGTTCCACCACTCGTAGCGCCTGATGCCTAGCCGCTCCA
JMFS060F07+ TTGAGACGCCGTGCAGCGCCTCGTTCCACCACTCGTAGCGCCTGATGCCTAGCCGCTCCA
JMFS052D05+ TTGAGACGCCGTGCAGCGCCTCGTTCCACCACTCGTAGCGCCTGATGCCTAGCCGCTCCA
JMFS045A04+ TTGAGACGCCGTGCAGCGCCTCGTTCCACCACTTGTAGCGC
JMFS041A03+ TTGAGACGCCGTGCAGCGCCTCGTTCCACCACTCGTAGCGCCTGATGCCTAGCCGCTCCA
                      ____________________________________________________________
consensus TTGAGACGCCGTGCAGCGCCTCGTTCCACCACTCGTAGCGCCTGATGCCTAGCCGCTCCA
 
. : . : . : . : . : . :
JMFS118B10+ CCGGGGCTGCATTGTTCACTAGGAGCCTGATCTTCTCTTGCAACGTCAACCGTCCGATCA
JMFS104A11+ CCGGGGCTGCATTGTTCACTAGGAGCCTGATCTTCTCTTGCAACGTCAACCGTCCGATCA
JMFS060F07+ CCGGGGCTGCATTGTTCACTAGGAGCCTGATCTTCTCTTGCAACGTCAACCGTCCGATCA
JMFS052D05+ CCGGGGCTGCATTGTTCACTAGGAGCCTGATCTTCTCTTGCAACGTCAACCGTCCGATCA
JMFS041A03+ CCGGGGCTGCATTGTTCACTAGGAGCCTGATCTTCTCTTGCAACGTCAACCGTCCGATCA
                      ____________________________________________________________
consensus CCGGGGCTGCATTGTTCACTAGGAGCCTGATCTTCTCTTGCAACGTCAACCGTCCGATCA
 
. : . : . : . : . : . :
JMFS118B10+ AGTCTCGGACCCTGACTTGTATGGGCAGATTCGTCTTACAGAACGGTAGAGACCTTGTAA
JMFS104A11+ AGTCTCGGACCCTGACTTGTATGGGCAGATTCGTCTTACAGAACGGTAGAGACCTTGTAA
JMFS060F07+ AGTCTCGGACCCTGACTTGTATGGGCAGATTCGTCTTACAGAACGGTAGAGACCTTGTAA
JMFS052D05+ AGTCTCGGACCCTGACTTGTATGGGCAGATTCGTCTTACAGAACGGTAGAGACCTTGTAA
JMFS041A03+ AGTCTCGGACCCTGACTTGTATGGGCAGATTCGTCTTACAGAACGGTAGAGACCTTGTAA
                      ____________________________________________________________
consensus AGTCTCGGACCCTGACTTGTATGGGCAGATTCGTCTTACAGAACGGTAGAGACCTTGTAA
 
. : . : . : . : . : . :
JMFS118B10+ CGCTATTGCTGGGATCGCATGCTAGTCCCGGACCGGACATTGAGGTTTGCAATTCAAAGC
JMFS104A11+ CGCTATTGCTGGGATCGCATGCTAGTCCCGGACCGGACATTGAGGTTTGCAATTCAAAGC
JMFS060F07+ CGCTATTGCTGGGATCGCATGCTAGTCCCGGACCGGACATTGAGGTTTGCAATTCAAAGC
JMFS052D05+ CGCTATTGCTGGGATCGCATGCTAGTCCCGGACCGGACATTGAGGTTTGCAATTCAAAGC
JMFS041A03+ CGCTATTGCTGGGATCGCATGCTAGTCCCGGACCGGACATTGAGGTTTGCAATTCAAAGC
                      ____________________________________________________________
consensus CGCTATTGCTGGGATCGCATGCTAGTCCCGGACCGGACATTGAGGTTTGCAATTCAAAGC
 
. : . : . : . : . : . :
JMFS118B10+ ATGCATAGAAGATGGAGAAGAAGAAGAGAATAAAA
JMFS104A11+ ATGCATAGAAGATGGAGAAGAAGAAGAGAATAAAAGAGAATTTTTTGGTAATAATAATGA
JMFS060F07+ ATGCATAGAAGATGGAGAAGAAGAAGAGAATAAAAGAGAATTTTTTGGTAATAATAATGA
JMFS052D05+ ATGCATAGAAGATGGAGAAGAAGAAGAGAATAAAAGAGAATTTTTTGGTAATAATAATGA
JMFS041A03+ ATGCATAGAAGATGGAGAAGAAGAAGAGAATAAAAGAGAATTTTTTGGTAATAATAATGA
                      ____________________________________________________________
consensus ATGCATAGAAGATGGAGAAGAAGAAGAGAATAAAAGAGAATTTTTTGGTAATAATAATGA
 
. : . : . : . : . : . :
JMFS104A11+ TATTAGTATATTCCATAGTGATAACACCGATAATAATATGTTA
JMFS060F07+ TATTAGTATATTCCATAGTGATAACACCGATAATAATATGTTACACTTGGTGTGGAAA
JMFS052D05+ TATTAGTATATTCCATAGTGATAACACCGATAATAATATGTTA
JMFS041A03+ TATTAGTATATTCCATAGTGATAACACCGATAATAATATGTTACACTTGGTGTGGAAAGC
                      ____________________________________________________________
consensus TATTAGTATATTCCATAGTGATAACACCGATAATAATATGTTACACTTGGTGTGGAAAGC