Previous Contig 003195:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN017J05Sequence623003195 (4)pir|B86206|B862062e-35protein F10K1.17 [imported] - Arabidopsis thaliana>gb:AE005172_889714 Arabidopsi
JMFN034N07Sequence630003195 (4)pir|B86206|B862062e-36protein F10K1.17 [imported] - Arabidopsis thaliana>gb:AE005172_889714 Arabidopsi
JMFN042N11Sequence598003195 (4)pir|B86206|B862069e-36protein F10K1.17 [imported] - Arabidopsis thaliana>gb:AE005172_889714 Arabidopsi
JMFS040H07Sequence627003195 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN017J05+ TGATCTGTTTGCCAGTTAACAAAACCAAAT
                      ____________________________________________________________
consensus TGATCTGTTTGCCAGTTAACAAAACCAAAT
 
. : . : . : . : . : . :
JMFN017J05+ TCAAGTACATAGTACGTGGCAACGTACACGCCTAACATTTCTGGTCTCTAGATGTTTCCA
                      ____________________________________________________________
consensus TCAAGTACATAGTACGTGGCAACGTACACGCCTAACATTTCTGGTCTCTAGATGTTTCCA
 
. : . : . : . : . : . :
JMFN017J05+ CAGTGGTTGTACTAACATTGTAACAATTACGAGATAGCTTAATGCAATCTAGCCAATGGA
JMFN042N11+ GTACTAACATTGTAACAATTACGAGATAGCTTAATGCAATCTAGCCAATGGA
JMFN034N07+ GTACTAACATTGTAACAATTACGAGATAGCTTAATGCAATCTAGCCAATGGA
                      ____________________________________________________________
consensus CAGTGGTTGTACTAACATTGTAACAATTACGAGATAGCTTAATGCAATCTAGCCAATGGA
 
. : . : . : . : . : . :
JMFN017J05+ GGATCTCAAAATTAGGATCTCTCTCGACGATGACGTCAGACACAGTTATCTGTACGGATC
JMFN042N11+ GGATCTCAAAATTAGGATCTCTCTCGACGATGACGTCAGACACAGTTATCTGTACGGATC
JMFN034N07+ GGATCTCAAAATTAGGATCTCTCTCGACGATGACGTCAGACACAGTTATCTGTACGGATC
                      ____________________________________________________________
consensus GGATCTCAAAATTAGGATCTCTCTCGACGATGACGTCAGACACAGTTATCTGTACGGATC
 
. : . : . : . : . : . :
JMFN017J05+ CGCGGTAGCCGGTGATCTTTCCCCGGACTCTAGCGAGGACGCCGAGTTGAGCTTCGGAGG
JMFN042N11+ CGCGGTAGCCGGTGATCTTTCCCCGGACTCTAGCGAGGACGCCGAGTTGAGCTTCGGAGG
JMFN034N07+ CGCGGTAGCCGGTGATCTTTCCCCGGACTCTAGCGAGGACGCCGAGTTGAGCTTCGGAGG
                      ____________________________________________________________
consensus CGCGGTAGCCGGTGATCTTTCCCCGGACTCTAGCGAGGACGCCGAGTTGAGCTTCGGAGG
 
. : . : . : . : . : . :
JMFN017J05+ CAAACTTGACAGCCATTTCGGCAATTGCTCGAACATCTGGTGGGCTTCTGCGAGAGAAAT
JMFN042N11+ CAAACTTGACAGCCATTTCGGCAATTGCTCGAACATCTGGTGGGCTTCTGCGAAAGAAAT
JMFN034N07+ CAAACTTGACAGCCATTTCGGCAATTGCTCGAACATCTGGTGGGCTTCTGCGAGAGAAAT
                      ____________________________________________________________
consensus CAAACTTGACAGCCATTTCGGCAATTGCTCGAACATCTGGTGGGCTTCTGCGAGAGAAAT
 
. : . : . : . : . : . :
JMFN017J05+ ACGGAGAGCTCAACTGGTTGAGCCAAAGCACGCAGGGGATGCAACCAGTGGTGTCATCAA
JMFN042N11+ ACGGAGAGCTCAACTGGTTGAGCCAAAGCACGCAGGGGATGCAACCAGTGGTGTCATCAA
JMFN034N07+ ACGGAGAGCTCAACTGGTTGAGCCAAAGCACGCAGGGGATGCAACCAGTGGTGTCATCAA
                      ____________________________________________________________
consensus ACGGAGAGCTCAACTGGTTGAGCCAAAGCACGCAGGGGATGCAACCAGTGGTGTCATCAA
 
. : . : . : . : . : . :
JMFN017J05+ TGGAGAATTTCAAAAACCTTCCTAGCTTGAACTCCCGGCTTACGACCACGCCCACAGCCT
JMFN042N11+ TGGAGAATTTCAAAAACCTTCCTGGCTTGAACTCCCGGCTTACGACCACGCCCACAGCCT
JMFN034N07+ TGGAGAATTTCAAAAACCTTCCTGGCTTGAACTCCCGGCTTACGACCACGCCCACAGCCT
                      ____________________________________________________________
consensus TGGAGAATTTCAAAAACCTTCCTGGCTTGAACTCCCGGCTTACGACCACGCCCACAGCCT
 
. : . : . : . : . : . :
JMFN017J05+ CCGCCCAACAGAGGCGAACGCCATTGCGGGAGAATGAGGTTTGGTCTACAGAATTCGGCA
JMFN042N11+ CCGCCCAACAGAGGCGAACGCCATTGCGGGAGAATGAGGTTTGGTCTACAGAATTCGGCA
JMFN034N07+ CCGCCCAACAGAGGCGAACGCCATTGCGGGAGAATGAGGTTTGGTCTACAGAATTCGGCA
                      ____________________________________________________________
consensus CCGCCCAACAGAGGCGAACGCCATTGCGGGAGAATGAGGTTTGGTCTACAGAATTCGGCA
 
. : . : . : . : . : . :
JMFN017J05+ CGAGAGTGAGCAGATCAAAGGCTAACAGCTTCACGTGGGTGTTGAATAGGGATGCCGGAG
JMFN042N11+ CGAGAGTGAGCAGATCAAAGGCTAACAGCTTCACGTGGGTGTTGAATAGGGATGCCGGAG
JMFN034N07+ CGAGAGTGAGCAGATCAAAGGCTAACAGCTTCACGTGGGTGTTGAATAGGGATGCCGGAG
                      ____________________________________________________________
consensus CGAGAGTGAGCAGATCAAAGGCTAACAGCTTCACGTGGGTGTTGAATAGGGATGCCGGAG
 
. : . : . : . : . : . :
JMFN017J05+ CGTCCATCTCTCCATCACCGCCGCAAAATCATGATTCAAACT
JMFN042N11+ CGTCCATCTCTCCATCACCGCCGCAAAATCATGATTCAAACTGAGGATATTGTTGGCACC
JMFN034N07+ CGTCCATCTCTCCATCACCGCCGCAAAATCATGATTCAAACTGAGGATATTGTTGGCACC
JMFS040H07+ ATTCAAACTGAGGATATTGTTGGCACC
                      ____________________________________________________________
consensus CGTCCATCTCTCCATCACCGCCGCAAAATCATGATTCAAACTGAGGATATTGTTGGCACC
 
. : . : . : . : . : . :
JMFN042N11+ ATTTTCCAACCAATAAGCGCATTGAACATAAAATTTTGGTTGAAACGTCGCAATATGAC
JMFN034N07+ ATTTTCCAACCAATAAGCGCATTGAACATAAAATTTTGGTTGAAACGTCGCAATATGACA
JMFS040H07+ ATTTTCCAACCAATAAGCGCATTGAACATAAAATTTTGGTTGAAACGTCGCAATATGACA
                      ____________________________________________________________
consensus ATTTTCCAACCAATAAGCGCATTGAACATAAAATTTTGGTTGAAACGTCGCAATATGACA
 
. : . : . : . : . : . :
JMFN034N07+ TTATACACAACAAATTTGATCCAGTCTACTCCT
JMFS040H07+ TTATACACAACAAATTTGATCCAGTCTACTCCTGAACAGAATTGAAAAACAAACTTCCAA
                      ____________________________________________________________
consensus TTATACACAACAAATTTGATCCAGTCTACTCCTGAACAGAATTGAAAAACAAACTTCCAA
 
. : . : . : . : . : . :
JMFS040H07+ CAAATTAATTCTAAAAAATCAAATCAGTTATGCAAGCCACGCTCTAACTCCGATATTGTT
                      ____________________________________________________________
consensus CAAATTAATTCTAAAAAATCAAATCAGTTATGCAAGCCACGCTCTAACTCCGATATTGTT
 
. : . : . : . : . : . :
JMFS040H07+ TAAAAGCTAACATTTAATCCTATTTAGATCCATAAATTTAAGACTTAACACATTAAAATG
                      ____________________________________________________________
consensus TAAAAGCTAACATTTAATCCTATTTAGATCCATAAATTTAAGACTTAACACATTAAAATG
 
. : . : . : . : . : . :
JMFS040H07+ CAGAATATATGAATGAACATCAATCAAATTCAAGAAATTAATGTTATGCCGATCAATCGA
                      ____________________________________________________________
consensus CAGAATATATGAATGAACATCAATCAAATTCAAGAAATTAATGTTATGCCGATCAATCGA
 
. : . : . : . : . : . :
JMFS040H07+ TCTTGCCAGAAACTAGGTTAAATATCAACATTTTACACTAAATTAGAAATACTCTGCAGA
                      ____________________________________________________________
consensus TCTTGCCAGAAACTAGGTTAAATATCAACATTTTACACTAAATTAGAAATACTCTGCAGA
 
. : . : . : . : . : . :
JMFS040H07+ TGAGTTCGAGAAGATGAAATGTGAGTCTAATCCAGGCCCGCTAATCATAAACCCTAGAAG
                      ____________________________________________________________
consensus TGAGTTCGAGAAGATGAAATGTGAGTCTAATCCAGGCCCGCTAATCATAAACCCTAGAAG
 
. : . : . : . : . : . :
JMFS040H07+ GGCGTCAGAGAGAGCAGACATGACGACTCAAGGATTCAATCTCCGTGCACATTACCATGC
                      ____________________________________________________________
consensus GGCGTCAGAGAGAGCAGACATGACGACTCAAGGATTCAATCTCCGTGCACATTACCATGC
 
. : . : . : . : . : . :
JMFS040H07+ TTCCTTCATTATATGAATCCAGAGCATCGGCTTATTGTACACGGATCCATTGACAGACTA
                      ____________________________________________________________
consensus TTCCTTCATTATATGAATCCAGAGCATCGGCTTATTGTACACGGATCCATTGACAGACTA
 
. : . : . : . : . : . :
JMFS040H07+ CTGCAGAGTTAATTTCAACTCATATAACTATCTTCTAAGTAAGATTAAACAAGAAAACTA
                      ____________________________________________________________
consensus CTGCAGAGTTAATTTCAACTCATATAACTATCTTCTAAGTAAGATTAAACAAGAAAACTA