Previous Contig 003192:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS020F01Sequence626003192 (15)gb:AY078951_15681066e-59Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS033D04Sequence635003192 (15)gb:AY078951_15681066e-57Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS040E08Sequence613003192 (15)gb:AY078951_15681062e-51Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS047G03Sequence613003192 (15)gb:AY078951_15681068e-93Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS054E07Sequence631003192 (15)gb:AY078951_15681069e-58Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS069F02Sequence627003192 (15)gb:AY078951_15681063e-57Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS102F09Sequence622003192 (15)gb:AP003983_18359096e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS133A04Sequence618003192 (15)gb:AY078951_15681064e-56Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS133D01Sequence621003192 (15)gb:AY078951_15681065e-95Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS134G05Sequence614003192 (15)gb:AY078951_15681065e-76Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS144C08Sequence623003192 (15)gb:AY078951_15681066e-59Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS160H10Sequence615003192 (15)gb:AY078951_15681065e-63Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS163G09Sequence580003192 (15)gb:AY078951_15681062e-78Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMFS164F09Sequence563003192 (15)gb:AY078951_15681061e-46Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330
JMSF006J02Sequence356003192 (15)gb:AY078951_15681062e-04Arabidopsis thaliana AT3g03380/T21P5_20 mRNA, complete cds.>gb:BT002727_1636330

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS163G09+ CTCCAGCTCTAAAGAGCATATATCCTGGTTCTGCGACATAGACAAGGCCACAGTG
                      ____________________________________________________________
consensus CTCCAGCTCTAAAGAGCATATATCCTGGTTCTGCGACATAGACAAGGCCACAGTG
 
. : . : . : . : . : . :
JMFS163G09+ AAAACGGAAATTTCTAGCCTGTTGATAAGAAAGGGGGTGTATCACTGCACCACTAACTTC
                      ____________________________________________________________
consensus AAAACGGAAATTTCTAGCCTGTTGATAAGAAAGGGGGTGTATCACTGCACCACTAACTTC
 
. : . : . : . : . : . :
JMFS163G09+ CAAGAAGAAATCAGGAGTTATTGAGTGCAAATCCTGAACCATCAAAGCAATGGTCGATGA
                      ____________________________________________________________
consensus CAAGAAGAAATCAGGAGTTATTGAGTGCAAATCCTGAACCATCAAAGCAATGGTCGATGA
 
. : . : . : . : . : . :
JMFS163G09+ GACACCGCCTCTTTCAATTTGAAGTTCAACTATCTTTCCAACACTCTCGTCAAGTAGAGT
                      ____________________________________________________________
consensus GACACCGCCTCTTTCAATTTGAAGTTCAACTATCTTTCCAACACTCTCGTCAAGTAGAGT
 
. : . : . : . : . : . :
JMFS163G09+ TTCCATCTTGAGGAATTGTGTAATCACCTTCCCATTCATGCAAACAAGAACATCACCTGG
JMFS102F09+ ACCTTCACATTCATGCAAACAAGCACATCACCTAG
JMFS134G05+ ACCTTCCCATTCATGCAAACAAGAACATCACCTGG
                      ____________________________________________________________
consensus TTCCATCTTGAGGAATTGTGTAATCACCTTCCCATTCATGCAAACAAGAACATCACCTGG
 
. : . : . : . : . : . :
JMFS163G09+ CTCTAAGTGATTATAAGCTGGACCACCAGGCACCACAGAATCAACAACAAGCATTCCAGT
JMFS102F09+ CTCTAAGTGATTATAAGCTGGACCACCAGGCACCACAGAATCAACAACAAGCATTCCAGT
JMFS134G05+ CTCTAAGTGATTATAAGCTGGACCACCAGGCACCACAGAATCAACAACAAGCATTCCAGT
                      ____________________________________________________________
consensus CTCTAAGTGATTATAAGCTGGACCACCAGGCACCACAGAATCAACAACAAGCATTCCAGT
 
. : . : . : . : . : . :
JMFS163G09+ TTCACCCGGTGGAGATGAATTGCGCACCAACTGTTCTGTTTCACTTCGAAGACCAAGACG
JMFS102F09+ TTCACCCGGTGGAGATGAATTGCGCACCAA----TCTGTTTCACTTCGAAGACCAAGCCG
JMFS134G05+ TTCACCCGGTGGAGATGAATTGCGCACCAACTGTTCTGTTTCACTTCGAAGACCAAGACG
                      ____________________________________________________________
consensus TTCACCCGGTGGAGATGAATTGCGCACCAACTGTTCTGTTTCACTTCGAAGACCAAGACG
 
. : . : . : . : . : . :
JMFS163G09+ GCGGGTCTCGTCAAATCCTTTATGGACAAATGTCACCTGAAGCGTACCACGTGGAATAGT
JMFS102F09+ GCGGGTCTCGTCAAATCCTTTATGGACAAA-GTCACCTGAAGCCTACCACGAGGAATAGT
JMFS134G05+ GCGGGTCTCGTCAAATCCTTTATGGACAAATGTCACCTGAAGCGTACCACGTGGAATAGT
                      ____________________________________________________________
consensus GCGGGTCTCGTCAAATCCTTTATGGACAAATGTCACCTGAAGCGTACCACGTGGAATAGT
 
. : . : . : . : . : . :
JMFS163G09+ GACTGCCTCCCATTTGTTTGCAGAATCTCTTCCTTCTTGCAAAAATTTTAAAGCCCTTAC
JMFS102F09+ GACTGCCTCCCATTTGTTTGCAGAATCTCTTCCTTCTTGCAAAAATTTTAAAGCCCTTAC
JMFS134G05+ GACTGCCTCCCATTTGTTTGCAGAATCTCTTCCTTCTTGCAAAAATTTTAAAGCCCTTAC
JMFS047G03+ CAGAATCTCTTCCTTCTTGCAAAAATTTTAAAGCCCTTAC
                      ____________________________________________________________
consensus GACTGCCTCCCATTTGTTTGCAGAATCTCTTCCTTCTTGCAAAAATTTTAAAGCCCTTAC
 
. : . : . : . : . : . :
JMFS163G09+ AACTCGCTCTAAAGGGAGGAAAAATGCAGATGCACTTGATGACTT
JMFS102F09+ AACTCGCTCTAAAGGGAGGAAAAATGCAAAGGCACTTGATGACTTGCTCCCAGCATTCAA
JMFS134G05+ AACTCGCTCTAAAGGGAGGAAAAATGCAGATGCACTTGATGACTTGCTCCCAGCATTCAA
JMFS047G03+ AACTCGCTCTAAAGGGAGGAAAAATGCAGATGCACTTGATGACTTGCTCCCAGCATTCAA
                      ____________________________________________________________
consensus AACTCGCTCTAAAGGGAGGAAAAATGCAGATGCACTTGATGACTTGCTCCCAGCATTCAA
 
. : . : . : . : . : . :
JMFS102F09+ AGCAACTGCTCTGCCCT
JMFS134G05+ AGCAACTGCTCTGCCCTGCCAGTCAATTACAGGAGAGCCACTTGAACCCCCTTTTGTCCC
JMFS047G03+ AGCAACTGCTCTGCCCTGCCAGTCAATTACAGGAGAGCCACTTGAACCCCCTTTTGTCCC
JMFS133D01+ TGTCCC
                      ____________________________________________________________
consensus AGCAACTGCTCTGCCCTGCCAGTCAATTACAGGAGAGCCACTTGAACCCCCTTTTGTCCC
 
. : . : . : . : . : . :
JMFS134G05+ AGATGCAGCTTGCATATAGAAGGTATTGAAGTCATTGTAACCATCCTTCTTGTAATGTGG
JMFS047G03+ AGATGCAGCTTGCATATAGAAGGTATTGAAGTCATTGTAACCATCCTTCTTGTAATGTGG
JMFS133D01+ AGATGCAGCTTGCATATAGAAGGTATTGAAGTCATTGTAACCATCCTTCTTGTAATGTGG
                      ____________________________________________________________
consensus AGATGCAGCTTGCATATAGAAGGTATTGAAGTCATTGTAACCATCCTTCTTGTAATGTGG
 
. : . : . : . : . : . :
JMFS134G05+ AGCATCTCTATCTAAACGA
JMFS047G03+ AGCATCTCTATCTAAACGAGCAAGGGTGCCAGCCAAAATAGATACCTTCTCTCCACTATC
JMFS133D01+ AGCATCTCTATCTAAACGAGCAAGGGTGCCAGCCAAAATAGATACCTTCTCTCCACTATC
                      ____________________________________________________________
consensus AGCATCTCTATCTAAACGAGCAAGGGTGCCAGCCAAAATAGATACCTTCTCTCCACTATC
 
. : . : . : . : . : . :
JMFS047G03+ ATTCCCAACCACCCTGATTTCCAGTCCTACACATGCTGCATCAGGAGCGAGAGGAATCTC
JMFS133D01+ ATTCCCAACCACCCTGATTTCCAGTCCTACACATGCTGCATCAGGAGCGAGAGGAATCTC
JMFS160H10+ TCAGGAGCGAGAGGAATCTC
                      ____________________________________________________________
consensus ATTCCCAACCACCCTGATTTCCAGTCCTACACATGCTGCATCAGGAGCGAGAGGAATCTC
 
. : . : . : . : . : . :
JMFS047G03+ TTCATAGTTCAGAAATTGTATTGCACCAGGATCATATCGAAAAAAACCAAAATCATGAAC
JMFS133D01+ TTCATAGTTCAGAAATTGTATTGCACCAGGATCATATCGAAAAAAACCAAAATCATGAAC
JMFS160H10+ TTCATAGTTCAGAAATTGTATTGCACCAGGATCATATCGAAAAAAACCAAAATCATGAAC
JMFS144C08+ CATAGTTCAGAAATTGTATTGCACCAGGATCATATCGAAAAAAACCAAAATCATGAAC
JMFS020F01+ TCATAGTTCAGAAATTGTATTGCACCAGGATCATATCGAAAAAAACCAAAATCATGAAC
JMFS069F02+ TAGTTCAGAAATTGTATTGCACCAGGATCATATCGAAAAAAACCANAATCATGAAC
JMFS054E07+ TCATAGTTCAGAAATTGTATTGCACCAGGATCATATCGAAAAAAACCAAAATCATGAAC
JMFS133A04+ AATTGTATTGCACCAGGATCATATCGAAAAAAACCANAATCATGAAC
JMFS033D04+ AATTGTATTGCACCAGGATCATATCGAAAAAAACCAAAATCATGAAC
JMFS040E08+ CAAAATCATGAAC
                      ____________________________________________________________
consensus TTCATAGTTCAGAAATTGTATTGCACCAGGATCATATCGAAAAAAACCAAAATCATGAAC
 
. : . : . : . : . : . :
JMFS047G03+ AGGGTCTCTATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
JMFS133D01+ AGGGTCTCTATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
JMFS160H10+ AGGGTCTCTATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
JMFS144C08+ AGGGTCTCTATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
JMFS020F01+ AGGGTCTCTATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
JMFS069F02+ AGGGTCTCTATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
JMFS054E07+ AGGGTCTCTATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
JMFS133A04+ AGGGTCTCTATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
JMFS164F09+ ATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
JMFS033D04+ AGGGTCTCTATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
JMFS040E08+ AGGGTCTCTATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
                      ____________________________________________________________
consensus AGGGTCTCTATATATTGGATAGACAGGGATTTCTTCACGGTTCACAAACATTGCTTCAGC
 
. : . : . : . : . : . :
JMFS047G03+ GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
JMFS133D01+ GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
JMFS160H10+ GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
JMFS144C08+ GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
JMFS020F01+ GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
JMFS069F02+ GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
JMFS054E07+ GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
JMFS133A04+ GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
JMFS164F09+ GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
JMFS033D04+ GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
JMFS040E08+ GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
                      ____________________________________________________________
consensus GACCACAGGTCCAGGTTTAACAACATGTCTGTTAGTGAGTATAATTCCCCGGCGCTTATC
 
. : . : . : . : . : . :
JMFS047G03+ CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGCAAGC
JMFS133D01+ CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGCAAGC
JMFS160H10+ CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGCAAGC
JMFS144C08+ CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGCAAGC
JMFS020F01+ CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGCAAGC
JMFS069F02+ CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGCAAGC
JMFS054E07+ CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGGAAGC
JMFS133A04+ CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGCAAGC
JMFS164F09+ CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGCAAGC
JMFS033D04+ CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGCAAGC
JMFS040E08+ CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGCAAGC
                      ____________________________________________________________
consensus CACAACAAAGCCTGTTGCGTAGCCGGCACTGGCAGACTCGGTGTCGAAAGCTCGGCAAGC
 
. : . : . : . : . : . :
JMFS047G03+ TGTGGTCCGGATCACGACAACCGCGGGGACGAC
JMFS133D01+ TGTGGTCCGGATCACGACAACCGCGGGGACGACCTGGTTGAGCGCCCTCCGCCAATCCTC
JMFS160H10+ TGTGGTCCGGATCACGACAACCGCGGGGACGACCTGGTTGAGCGCCCTCCGCCAATCCTC
JMFS144C08+ TGTGGTCCGGATCACGACAACCGCGGGGACGACCTGGTTGAGCGCCCTCCGCCAATCCTC
JMFS020F01+ TGTGGTCCGGATCACGACAACCGCGGGGACGACCTGGTTGAGCGCCCTCCGCCAATCCTC
JMFS069F02+ TGTGGTCCGGATCACGACAACCGCGGGGACGACCTGGTTGAGCGCCCTCCGCCAATCCTC
JMFS054E07+ TGTGGTCCGGATCACGACAACCGCGGGGACGACCTGGTTGAGCGCCCTCCGCCAATCCTC
JMFS133A04+ TGTGGTCCGGATCACGACAACCGCGGGGACGACCTGGTTGAGCGCCCTCCGCCAATCCTC
JMFS164F09+ TGTGGTCCGGATCACGACAACCGCGGGGACGACCTGGTTGAGCGCCCTCCGCCAATCCTC
JMFS033D04+ TGTGGTCCGGATCACGACAACCGCGGGGACGACCTGGTTGAGCGCCCTCCGCCAATCCTC
JMSF006J02+ CCTC
JMFS040E08+ TGTGGTCCGGATCACGACAACCGCGGGGACGACCTGGTTGAGCGCCCTCCGCCAATCCTC
                      ____________________________________________________________
consensus TGTGGTCCGGATCACGACAACCGCGGGGACGACCTGGTTGAGCGCCCTCCGCCAATCCTC
 
. : . : . : . : . : . :
JMFS133D01+ GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
JMFS160H10+ GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
JMFS144C08+ GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
JMFS020F01+ GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
JMFS069F02+ GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
JMFS054E07+ GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
JMFS133A04+ GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
JMFS164F09+ GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
JMFS033D04+ GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
JMSF006J02+ GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
JMFS040E08+ GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
                      ____________________________________________________________
consensus GGCGGTAGCAAGGTTCTCCCTTAACGGAGGATCAATCTCCATAGACAAGTCCTCCTTCAG
 
. : . : . : . : . : . :
JMFS133D01+ CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
JMFS160H10+ CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
JMFS144C08+ CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
JMFS020F01+ CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
JMFS069F02+ CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
JMFS054E07+ CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
JMFS133A04+ CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
JMFS164F09+ CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
JMFS033D04+ CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
JMSF006J02+ CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
JMFS040E08+ CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
                      ____________________________________________________________
consensus CATAGTCGATTCCGGTCCCGAAACTCCCTCCGATCCAAAATTCTCCAGCGAATCCCCCAC
 
. : . : . : . : . : . :
JMFS133D01+ CTTGTAGAACCCTAA
JMFS160H10+ CTTGTAGAACCCTAATTCCCCCTCGCTGTCACAGAGTTCGAAACTTGATACAAACCTTTA
JMFS144C08+ CTTGTAGAACCCTAATTCCCCCTCGCTGTCACAGAGTTCGAAACTTGATACAAACCTTTA
JMFS020F01+ CTTGTAGAACCCTAATTCCCCCTCGCTGTCACAGAGTTCGAAACTTGATACAAACCTTTA
JMFS069F02+ CTTGTAGAACCCTAATTCCCCCTCGCTGTCACAGAGTTCGAAACTTGATACAAACCTTTA
JMFS054E07+ CTTGTAGAACCCTAATTCCCCCTCGCTGTCACAGAGTTCGAAACTTGATACAAACCTTTA
JMFS133A04+ CTTGTAGAACCCTAATTCCCCCTCGCTGTCACAGAGTTCGAAACTTGATACAAACCTTTA
JMFS164F09+ CTTGTAGAACCCTAATTCCCCCTCGCTGTCACAGAGTTCGAAACTTGATACAAACCTTTA
JMFS033D04+ CTTGTAGAACCCTAATTCCCCCTCGCTGTCACAGAGTTCGAAACTTGATACAAACCTTTA
JMSF006J02+ CTTGTAGAACCCTAATTCCCCCTCGCTGTCACAGAGTTCGAAACTTGATACAAACCTTTA
JMFS040E08+ CTTGTAGAACCCTAATTCCCCCTCGCTGTCACAGAGTTCGAAACTTGATACAAACCTTTA
                      ____________________________________________________________
consensus CTTGTAGAACCCTAATTCCCCCTCGCTGTCACAGAGTTCGAAACTTGATACAAACCTTTA
 
. : . : . : . : . : . :
JMFS160H10+ ACACAGTGCCAGAGTTTAGTGTCCGTATAAGCTTTAGGGCTACCGGCTACGTTGAGAAAT
JMFS144C08+ ACACAGTGCCAGAGTTTAGTGTCCGTATAAGCTTTAGGGCTACCGGCTACGTTGAGAAAT
JMFS020F01+ ACACAGTGCCAGAGTTTAGTGTCCGTATAAGCTTTAGGGCTACCGGCTACGTTGAGAAAT
JMFS069F02+ ACACAGTGCCAGAGTTTAGTGTCCGTATAAGCTTTAGGGCTACCGGCTACGTTGAGAAAT
JMFS054E07+ ACACAGTGCCAGAGTTTAGTGTCCGTATAAGCTTTAGGGCTACCGGCTACGTTGAGAAAT
JMFS133A04+ ACACAGTGCCAGAGTTTAGTGTCCGTATAAGCTTTAGGGCTACCGGCTACGTTGAGAAAT
JMFS164F09+ ACACAGTGCCAGAGTTTAGTGTCCGTATAAGCTTTAGGGCTACCGGCTACGTTGAGAAAT
JMFS033D04+ ACACAGTGCCAGAGTTTAGTGTCCGTATAAGCTTTAGGGCTACCGGCTACGTTGAGAAAT
JMSF006J02+ ACACAGTGCCAGAGTTTAGTGTCCGTATAAGCTTTAGGGCTACCGGCTACGTTGAGAAAT
JMFS040E08+ ACACAGTGCCAGAGTTTAGTGTCCGTATAAGCTTTAGGGCTACCGGCTACGTTGAGAAAT
                      ____________________________________________________________
consensus ACACAGTGCCAGAGTTTAGTGTCCGTATAAGCTTTAGGGCTACCGGCTACGTTGAGAAAT
 
. : . : . : . : . : . :
JMFS160H10+ ATGTTTCGAGGACGGGGAGAGAAATCCGGCGAGGTCTCTGGGCGAAAGATTT
JMFS144C08+ ATGTTTCGAGGACGGGGAGAGAAATCCGGCGAGGTCTCTGGGCGAAAGATTTTCTCTCTC
JMFS020F01+ ATGTTTCGAGGACGGGGAGAGAAATCCGGCGAGGTCTCTGGGCGAAAGATTTTCTCTCTC
JMFS069F02+ ATGTTTCGAGGACGGGGAGAGAAATCCGGCGAGGTCTCTGGGCGAAAGATTTTCTCTCTC
JMFS054E07+ ATGTTTCGAGGACGGGGAGAGAAATCCGGCGAGGTCTCTGGGCGAAAGATTTTCTCTCTC
JMFS133A04+ ATGTTTCGAGGACGGGGAGAGAAATCCGGCGAGGTCTCTGGGCGAAAGATTTTCTCTCTC
JMFS164F09+ ATGTTTCGAGGACGGGGAGAGAAATCCGGCGAGGTCTCTGGGCGAAAGATTTTCTCTCTC
JMFS033D04+ ATGTTTCGAGGACGGGGAGAGAAATCCGGCGAGGTCTCTGGGCGAAAGATTTTCTCTCTC
JMSF006J02+ ATGTTTCGAGGACGGGGAGAGAAATCCGGCGAGGTCTCTGGGCGAAAGATTTTCTCTCTC
JMFS040E08+ ATGTTTCGAGGACGGGGAGAGAAATCCGGCGAGGTCTCTGGGCGAAAGATTTTCTCTCTC
                      ____________________________________________________________
consensus ATGTTTCGAGGACGGGGAGAGAAATCCGGCGAGGTCTCTGGGCGAAAGATTTTCTCTCTC
 
. : . : . : . : . : . :
JMFS144C08+ TAGATGGAGGGAGAGAGAGATCGGA
JMFS020F01+ TAGATGGAGGGAGAGAGAGATCGGAGT
JMFS069F02+ TAGATGGAGGGAGAGAGAGATCGGAGTTTGG
JMFS054E07+ TAGATGGAGGGAGAGAGAGATCGGAGTTTGGG
JMFS133A04+ TAGATGGAGGGAGAGAGAGATCGGAGTTTGG
JMFS164F09+ TAGATGGAGGGAGAGAGAGATCGGAGTTTGGG
JMFS033D04+ TAGATGGAGGGAGAGAGAGATCGGAGTTTGGGATGAACTATGATTGAA
JMSF006J02+ TAGATGGAGGGAGAGAGAGATCGGAGTTTGGGATGAACTATGATTGAA
JMFS040E08+ TAGATGGAGGGAGAGAGAGATCGGAGTTTGGGATGAACTATGATTGAATGGAGTTGGTTC
                      ____________________________________________________________
consensus TAGATGGAGGGAGAGAGAGATCGGAGTTTGGGATGAACTATGATTGAATGGAGTTGGTTC