Previous Contig 003186:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS040C11Sequence625003186 (3)pir|T51532|T515325e-53hypothetical protein T20K14_150 - Arabidopsis thaliana>gb:ATT20K14_1554994 Arabi
JMFS041C11Sequence639003186 (3)pir|T51532|T515325e-53hypothetical protein T20K14_150 - Arabidopsis thaliana>gb:ATT20K14_1554994 Arabi
JMFS127C06Sequence613003186 (3)pir|T51532|T515328e-72hypothetical protein T20K14_150 - Arabidopsis thaliana>gb:ATT20K14_1554994 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS127C06+ CTGCTTGC
                      ____________________________________________________________
consensus CTGCTTGC
 
. : . : . : . : . : . :
JMFS127C06+ CAAATTTACGCTATTGCTGTGTTGGGATGCACTCAGTAAAGTGCTACCATAGCGTATTAG
                      ____________________________________________________________
consensus CAAATTTACGCTATTGCTGTGTTGGGATGCACTCAGTAAAGTGCTACCATAGCGTATTAG
 
. : . : . : . : . : . :
JMFS127C06+ CAAGCCCAAACAGAAGAGAGATCGACCAACTTGCTGCTTATTATCAAGACCAAAACCAAG
                      ____________________________________________________________
consensus CAAGCCCAAACAGAAGAGAGATCGACCAACTTGCTGCTTATTATCAAGACCAAAACCAAG
 
. : . : . : . : . : . :
JMFS127C06+ GCTACCCAAACGTCTGAAGAATAACTGAACAAGATATTCAACAACTGTTGCACCTTTTCC
                      ____________________________________________________________
consensus GCTACCCAAACGTCTGAAGAATAACTGAACAAGATATTCAACAACTGTTGCACCTTTTCC
 
. : . : . : . : . : . :
JMFS127C06+ TGCTACTTTACTTACAGAGCAGAGGCACTTGATGCAAGCATGGACAACAGTTAAGAAAGA
                      ____________________________________________________________
consensus TGCTACTTTACTTACAGAGCAGAGGCACTTGATGCAAGCATGGACAACAGTTAAGAAAGA
 
. : . : . : . : . : . :
JMFS127C06+ ATGCCGAACAATCATTTGCTTCAGATCTTGTTCAAGTTCTTCAATAACACTTTGAGGAAG
                      ____________________________________________________________
consensus ATGCCGAACAATCATTTGCTTCAGATCTTGTTCAAGTTCTTCAATAACACTTTGAGGAAG
 
. : . : . : . : . : . :
JMFS127C06+ CTTCCGTAGCAAAGGCAAAACAGAATCAATTACAAAGATTATACTCTCCAGAAGTTGGGC
                      ____________________________________________________________
consensus CTTCCGTAGCAAAGGCAAAACAGAATCAATTACAAAGATTATACTCTCCAGAAGTTGGGC
 
. : . : . : . : . : . :
JMFS127C06+ AGCTACTCGGTTGTCAGCCTGACTCTTTAAGTAAGGCTGCAGTGTGACCACAAATCTAGA
JMFS041C11+ ACTCTTTAAGTAAGGCTGCAGTGTGACCACAAATCTAGA
JMFS040C11+ GCTGCAGTGTGACCACAAATCTAGA
                      ____________________________________________________________
consensus AGCTACTCGGTTGTCAGCCTGACTCTTTAAGTAAGGCTGCAGTGTGACCACAAATCTAGA
 
. : . : . : . : . : . :
JMFS127C06+ AGGATCTGAAGATGGTGCACAAAGAGTGGGATCCACAACACAAAAGGCATGCAACAGCAG
JMFS041C11+ AGGATCTGAAGATGGTGCACAAAGAGTGGGATCCACAACACAAAAGGCATGCAACAGCAG
JMFS040C11+ AGGATCTGAAGATGGTGCACAAAGAGTGGGATCCACAACACAAAAGGCATGCAACAGCAG
                      ____________________________________________________________
consensus AGGATCTGAAGATGGTGCACAAAGAGTGGGATCCACAACACAAAAGGCATGCAACAGCAG
 
. : . : . : . : . : . :
JMFS127C06+ CATATATGGAAGCATTCGAGCCTCTCCTCCATAATTCATTTCTGCCACCTG
JMFS041C11+ CATATATGGAAGCATTCGAGCCTCTCCTCCATAATTCATTTCTGCCACCTGAGCATTCGG
JMFS040C11+ CATATATGGAAGCATTCGAGCCTCTCCTCCATAATTCATTTCTGCCACCTGAGCATTCGG
                      ____________________________________________________________
consensus CATATATGGAAGCATTCGAGCCTCTCCTCCATAATTCATTTCTGCCACCTGAGCATTCGG
 
. : . : . : . : . : . :
JMFS041C11+ ATATTCATATGCCAACGCATGCAACAAACAAAACAACAAAAAGGAGCAACCAACAAACAA
JMFS040C11+ ATATTCATATGCCAACGCATGCAACAAACAAAACAACAAAAAGGAGCAACCAACAAACAA
                      ____________________________________________________________
consensus ATATTCATATGCCAACGCATGCAACAAACAAAACAACAAAAAGGAGCAACCAACAAACAA
 
. : . : . : . : . : . :
JMFS041C11+ CACGCATTAAAACAAAGAACCTGCAGTATTTTCTCCAACAAGCACTTGCACATAAGCTCA
JMFS040C11+ CACGCATTAAAACAAAGAACCTGCAGTATTTTCTCCAACAAGCACTTGCACATAAGCTCA
                      ____________________________________________________________
consensus CACGCATTAAAACAAAGAACCTGCAGTATTTTCTCCAACAAGCACTTGCACATAAGCTCA
 
. : . : . : . : . : . :
JMFS041C11+ CAACGCCTACGAACTGAAGCAAGTGATACAGGGTTGATACCAGCAGCTTTAGCTGACTGC
JMFS040C11+ CAACGCCTACGAACTGAAGCAAGTGATACAGGGTTGATACCAGCAGCTTTAGCTGACTGC
                      ____________________________________________________________
consensus CAACGCCTACGAACTGAAGCAAGTGATACAGGGTTGATACCAGCAGCTTTAGCTGACTGC
 
. : . : . : . : . : . :
JMFS041C11+ GGAAAGAAATCAAGGGCTAAGTTACGTTTAATAACAGTTACAAGAGGTTGATGGGTTGGC
JMFS040C11+ GGAAAGAAATCAAGGGCTAAGTTACGTTTAATAACAGTTACAAGAGGTTGATGGGTTGGC
                      ____________________________________________________________
consensus GGAAAGAAATCAAGGGCTAAGTTACGTTTAATAACAGTTACAAGAGGTTGATGGGTTGGC
 
. : . : . : . : . : . :
JMFS041C11+ ATCCTTCTCATCATGTCAACAATTTGCTCAGTTTTCTTAGACACCTCAATTGGAACAGAA
JMFS040C11+ ATCCTTCTCATCATGTCAACAATTTGCTCAGTTTTCTTAGACACCTCAATTGGAACAGAA
                      ____________________________________________________________
consensus ATCCTTCTCATCATGTCAACAATTTGCTCAGTTTTCTTAGACACCTCAATTGGAACAGAA
 
. : . : . : . : . : . :
JMFS041C11+ CTGCCATCTCCAAAAGACTGACTATGTGAACCAGAAGATTCATCAAACCAGAAGTCATAA
JMFS040C11+ CTGCCATCTCCAAAAGACTGACTATGTGAACCAGAAGATTCATCAAACCAGAAGTCATAA
                      ____________________________________________________________
consensus CTGCCATCTCCAAAAGACTGACTATGTGAACCAGAAGATTCATCAAACCAGAAGTCATAA
 
. : . : . : . : . : . :
JMFS041C11+ AATGTCTTGCACACGAGATCCTGCACACTCGATTCTTCATCATTAACACGGGAAATAATC
JMFS040C11+ AATGTCTTGCACACGAGATCCTGCACACTCGATTCTTCATCATTAACACGGGAAATAATC
                      ____________________________________________________________
consensus AATGTCTTGCACACGAGATCCTGCACACTCGATTCTTCATCATTAACACGGGAAATAATC
 
. : . : . : . : . : . :
JMFS041C11+ TCAATACAAGCAGTAGAAAACTCTGAGAAGTTGGAATTTGAAGTGCACATGTCCCGTATG
JMFS040C11+ TCAATACAAGCAGTAGAAAACTCTGAGAAGTTGGAATTTGAAGTGCACATGTCCCGTATG
                      ____________________________________________________________
consensus TCAATACAAGCAGTAGAAAACTCTGAGAAGTTGGAATTTGAAGTGCACATGTCCCGTATG