Previous Contig 003182:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS040A10Sequence621003182 (5)gb:AF194022_1775668e-100Nicotiana tabacum sucrose-6-phosphate synthase (SPS) mRNA, complete cds.
JMFS100E02Sequence622003182 (5)gb:AF439861_18000252e-53Ipomoea batatas sucrose-phosphate synthase mRNA, complete cds.
JMFS132H06Sequence466003182 (5)
JMFS146A03Sequence490003182 (5)
JMFS166D06Sequence627003182 (5)gb:AF439861_18000259e-69Ipomoea batatas sucrose-phosphate synthase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS146A03+ AAGGCATGA
                      ____________________________________________________________
consensus AAGGCATGA
 
. : . : . : . : . : . :
JMFS146A03+ AACTGCAGCATTTCCAGTATCAGAATATGTTCACAAAATTTTTCAAAAAAGATAAGTGCA
JMFS132H06+ AGTATCAGAATATGTTCACAAAATTTTTCAAAAAAGATAAGTGCA
                      ____________________________________________________________
consensus AACTGCAGCATTTCCAGTATCAGAATATGTTCACAAAATTTTTCAAAAAAGATAAGTGCA
 
. : . : . : . : . : . :
JMFS146A03+ CTACATACTGTGCACTTGATTCCCCTAACACTATAAGAACCACAGGGGCACCACATATAT
JMFS132H06+ CTACATACTGTGCACTTGATTCCCCTAACACTATAAGAACCACAGGGGCTCCACATATAT
                      ____________________________________________________________
consensus CTACATACTGTGCACTTGATTCCCCTAACACTATAAGAACCACAGGGGCTCCACATATAT
 
. : . : . : . : . : . :
JMFS146A03+ ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAA
JMFS132H06+ ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAA
                      ____________________________________________________________
consensus ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAA
 
. : . : . : . : . : . :
JMFS146A03+ ACGTTGAAATATCTCAGGTTGGTTTTCATATTTGTAACTTATTCATCACTTTCTTCTGAA
JMFS132H06+ ACGTTGAAATATCTCAGGTTGGTTTTCATATTTGTAACTTATTCATCACTTTCTTCTGAA
JMFS100E02- TATTTGTAACTTATTCATCACTTTCTTCTGAA
                      ____________________________________________________________
consensus ACGTTGAAATATCTCAGGTTGGTTTTCATATTTGTAACTTATTCATCACTTTCTTCTGAA
 
. : . : . : . : . : . :
JMFS146A03+ TTATCAAACTGTATCATGCCTCCAACATAGATACCAAATTCAACTGTACAGGCATTGCAA
JMFS132H06+ TTATCAAACTGTATCATGCCTCCAACATAGATACCAAATTCAACTGTACAGGCATTGCAA
JMFS100E02- TTATCAAACTGTATCATGCCTCCAACATAGATACCAAATTCAACTGTACAGGCATTGCAA
                      ____________________________________________________________
consensus TTATCAAACTGTATCATGCCTCCAACATAGATACCAAATTCAACTGTACAGGCATTGCAA
 
. : . : . : . : . : . :
JMFS146A03+ AGAAGGCATCAAATGAGAGCAAGTATTAAGGTGTGTCTTTGAGAACGAGCAACAAAGTTT
JMFS132H06+ AGAAGGCATCAAATGAGAGCAAGTATTAAGGTGTGTCTTTGAGAACGAGCAACAAAGTTT
JMFS100E02- AGAAGGCATCAAATGAGAGCAAGTATTAAGGTGTGTCTTTGAGAACGAGCAACAAAGTTT
                      ____________________________________________________________
consensus AGAAGGCATCAAATGAGAGCAAGTATTAAGGTGTGTCTTTGAGAACGAGCAACAAAGTTT
 
. : . : . : . : . : . :
JMFS146A03+ TGAATCTTACTTGAGTAACATCTCCAGAACCAGAAGACTATAACTAATAACTTCGTCTTG
JMFS132H06+ TGAATCTTACTTGAGTAACATCTCCAGAACCAGAAGACTATAACTAATAACTTCGTCTTG
JMFS100E02- TGAATCTTACTTGAGTAACATCTCCAGAACCAGAAGACTATAACTAATAACTTCGTCTTG
JMFS166D06+ TTGAGTAACATCTCCAGAACCAGAAGACTATAACTAATAACTTCGTCTTG
                      ____________________________________________________________
consensus TGAATCTTACTTGAGTAACATCTCCAGAACCAGAAGACTATAACTAATAACTTCGTCTTG
 
. : . : . : . : . : . :
JMFS146A03+ TTCATAACATCCGAGCTCTGGTCCGGACAGAATATCCCGCGGATTCTATCCTTTGAGAAC
JMFS132H06+ TTCATAACATCCGAGCTCTGGTCCGGACAGAATATCCCGCGGATTCTATCCTTTGAGAAC
JMFS100E02- TTCATAACATCCGAGCTCTGGTCCGGACAGAATATCCCGCGGATTCTATCCTTTGAGAAC
JMFS166D06+ TTCATAACATCCGAGCTCTGGTCCGGACAGAATATCCCGCGGATTCTATCCTTTGAGAAC
                      ____________________________________________________________
consensus TTCATAACATCCGAGCTCTGGTCCGGACAGAATATCCCGCGGATTCTATCCTTTGAGAAC
 
. : . : . : . : . : . :
JMFS146A03+ A
JMFS132H06+ A
JMFS100E02- ACCTAGCTTCTCCAATGAAGCACGGAGTTCTGAGCTGCTGCATTCTTCAGTTGTCTGGAT
JMFS166D06+ ACCTAGCTTCTCCAATGAAGCACGGAGTTCTGAGCTGCTGCATTCTTCAGTTGTCTGGAT
                      ____________________________________________________________
consensus ACCTAGCTTCTCCAATGAAGCACGGAGTTCTGAGCTGCTGCATTCTTCAGTTGTCTGGAT
 
. : . : . : . : . : . :
JMFS100E02- AACGTTGGGGCTGTTGTAAGGGACGACGTCTGTAAGTGGATAATTCCTATTCGAAAGAAG
JMFS166D06+ AACGTTGGGGCTGTTGTAAGGGACGACGTCTGTAAGTGGATAATTCCTATTCGAAAGAAG
                      ____________________________________________________________
consensus AACGTTGGGGCTGTTGTAAGGGACGACGTCTGTAAGTGGATAATTCCTATTCGAAAGAAG
 
. : . : . : . : . : . :
JMFS100E02- TTGACTGCTAGAAACACTGCACACTCCTTTCAGTATTACAGCTTTCCTTAGACCTCCAAG
JMFS166D06+ TTGACTGCTAGAAACACTGCACACTCCTTTCAGTATTACAGCTTTCCTTAGACCTCCAAG
JMFS040A10+ TTAGACCTCCAAG
                      ____________________________________________________________
consensus TTGACTGCTAGAAACACTGCACACTCCTTTCAGTATTACAGCTTTCCTTAGACCTCCAAG
 
. : . : . : . : . : . :
JMFS100E02- CAATCCTTCATAGTCGGTGTCCCCGCTTTCGCCTACAAAGACCACCAACTTTGACAAGTC
JMFS166D06+ CAATCCTTCATAGTCGGTGTCCCCGCTTTCGCCTACAAAGACCACCAACTTTGACAAGTC
JMFS040A10+ CAATCNTTCATAGTCGGTGTCNCCGCTTTCGCCTACAAAGACCACCAACTTTGACAAGTC
                      ____________________________________________________________
consensus CAATCCTTCATAGTCGGTGTCCCCGCTTTCGCCTACAAAGACCACCAACTTTGACAAGTC
 
. : . : . : . : . : . :
JMFS100E02- CATACCCCACCGCAGATACAAGTACCTGAGTGCTTGGGAACGAGAGGACAACACTGGAAT
JMFS166D06+ CATACCCCACCGCAGATACAAGTACCTGAGTGCTTGGGAACGAGAGGACAACACTGGAAT
JMFS040A10+ CATACCCCACCGCAGATACAAGTACCTGAGTGCTTGGGAACGAGAGGACAACACTGGAAT
                      ____________________________________________________________
consensus CATACCCCACCGCAGATACAAGTACCTGAGTGCTTGGGAACGAGAGGACAACACTGGAAT
 
. : . : . : . : . : . :
JMFS100E02- TACATTGATCCTGCTGC
JMFS166D06+ TACATTGATCCTGCTGCCATTTTGACAATAAACGACATGACAACGGAGAGCCTGGATTCT
JMFS040A10+ TACATTGATCCTGCTGCCATTTTGACAATAAACGACATGACAACGGAGAGCCTGGATTCT
                      ____________________________________________________________
consensus TACATTGATCCTGCTGCCATTTTGACAATAAACGACATGACAACGGAGAGCCTGGATTCT
 
. : . : . : . : . : . :
JMFS166D06+ CATCAACTTCCTAAGCTCCTTAACAGAGGGGTC
JMFS040A10+ CATCAACTTCCTAAGCTCCTTAACAGAGGGGTCTCCAGACTTGTGAACTTTAAAAGTATA
                      ____________________________________________________________
consensus CATCAACTTCCTAAGCTCCTTAACAGAGGGGTCTCCAGACTTGTGAACTTTAAAAGTATA
 
. : . : . : . : . : . :
JMFS040A10+ GCAGTAGTCAGCTGAATTCTTTTCATCTTCAACAATGTGCTCTTCTTTTTCACCCTTCTT
                      ____________________________________________________________
consensus GCAGTAGTCAGCTGAATTCTTTTCATCTTCAACAATGTGCTCTTCTTTTTCACCCTTCTT
 
. : . : . : . : . : . :
JMFS040A10+ ATCAGAAATAGAAGCTGCCCAACGCACTAAAGTCTTTCTCAACCCTTCTCCACCCCAGCG
                      ____________________________________________________________
consensus ATCAGAAATAGAAGCTGCCCAACGCACTAAAGTCTTTCTCAACCCTTCTCCACCCCAGCG
 
. : . : . : . : . : . :
JMFS040A10+ GTATTCAATGTGGGAATGGTAGTACAAGTCAACTACAAAAGGATTATCTTCAGAATGGAA
                      ____________________________________________________________
consensus GTATTCAATGTGGGAATGGTAGTACAAGTCAACTACAAAAGGATTATCTTCAGAATGGAA
 
. : . : . : . : . : . :
JMFS040A10+ AGATGAATAATAAAGATCACCACCACTATTGCAAATGAAAGCATCAAAATCAGTAGGATT
                      ____________________________________________________________
consensus AGATGAATAATAAAGATCACCACCACTATTGCAAATGAAAGCATCAAAATCAGTAGGATT
 
. : . : . : . : . : . :
JMFS040A10+ CATGCCCTCTGAAATCAGAAAAGAATGCACTTCTGATATATTGAATGCAGTGGCCAATAT
                      ____________________________________________________________
consensus CATGCCCTCTGAAATCAGAAAAGAATGCACTTCTGATATATTGAATGCAGTGGCCAATAT
 
. : . : . : . : . : . :
JMFS040A10+ GAACCCTACGGAGCCTTCCATCCTTTCCGCCTCCACAGCTGCAAAGATCTTTCTCACATT
                      ____________________________________________________________
consensus GAACCCTACGGAGCCTTCCATCCTTTCCGCCTCCACAGCTGCAAAGATCTTTCTCACATT