Previous Contig 003181:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003A20Sequence479003181 (4)pir|T05005|T050052e-11hypothetical protein T19P19.70 - Arabidopsis thaliana>gb:ATCHRIV91_1547952 Arabi
JMFS040A06Sequence633003181 (4)pir|T05005|T050054e-11hypothetical protein T19P19.70 - Arabidopsis thaliana>gb:ATCHRIV91_1547952 Arabi
JMFS072G01Sequence627003181 (4)pir|T05005|T050054e-11hypothetical protein T19P19.70 - Arabidopsis thaliana>gb:ATCHRIV91_1547952 Arabi
JMFS122E12Sequence574003181 (4)pir|T05005|T050053e-11hypothetical protein T19P19.70 - Arabidopsis thaliana>gb:ATCHRIV91_1547952 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS072G01+ CCTTCAACAACTTTACCATCATCAGATGGCGTTCTGTTGTCAC
JMFS040A06+ CTTTACCATCATCAGATGGCGTTCTGTTGTCAC
                      ____________________________________________________________
consensus CCTTCAACAACTTTACCATCATCAGATGGCGTTCTGTTGTCAC
 
. : . : . : . : . : . :
JMFS072G01+ CAAGATCAACTTTATGCACTTCACTTTCCACTTTATCACCTATTGAATCACAAGCAGCAG
JMFS122E12+ ACTTTATGCACTTCACTTTCCACTTTATCACCTATTGAATCACAAGCAGCAG
JMFS040A06+ CAAGATCAACTTTATGCACTTCACTTTCCACTTTATCACCTATTGAATCACAAGCAGCAG
                      ____________________________________________________________
consensus CAAGATCAACTTTATGCACTTCACTTTCCACTTTATCACCTATTGAATCACAAGCAGCAG
 
. : . : . : . : . : . :
JMFS072G01+ GAGCATCCTTCTCCTTGTTAGCATCAAATAACTCAGTCTTTTCTTTTTCAGATTCAACTT
JMFS122E12+ GAGCATCCTTCTCCTTGTTAGCATCAAATAACTCAGTCTTTTCTTTTTCAGATTCAACTT
JMFF003A20+ TCAGATTCAACTT
JMFS040A06+ GAGCATCCTTCTCCTTGTTAGCATCAAATAACTCAGTCTTTTCTTTTTCAGATTCAACTT
                      ____________________________________________________________
consensus GAGCATCCTTCTCCTTGTTAGCATCAAATAACTCAGTCTTTTCTTTTTCAGATTCAACTT
 
. : . : . : . : . : . :
JMFS072G01+ TAGACTCGGGGGCAGAGTCAAAACCATCGCCAGTGTTTCCCTGTTCACTTTCCTGCTCAC
JMFS122E12+ TAGACTCGGGGGCAGAGTCAAAACCATCGCCAGTGTTTCCCTGTTCACTTTCCTGCTCAC
JMFF003A20+ TAGACTCGGGGGCAGAGTCAAAACCATCGCCAGTGTTTCCCTGTTCACTTTCCTGCTCAC
JMFS040A06+ TAGACTCGGGGGCAGAGTCAAAACCATCGCCAGTGTTTCCCTGTTCACTTTCCTGCTCAC
                      ____________________________________________________________
consensus TAGACTCGGGGGCAGAGTCAAAACCATCGCCAGTGTTTCCCTGTTCACTTTCCTGCTCAC
 
. : . : . : . : . : . :
JMFS072G01+ TGCGAAGTGCTTCATCCAACCGCTTCACCAAATCTTCCTTCAGCCCTTTTGTTGTTAACT
JMFS122E12+ TGCGAAGTGCTTCATCCAACCGCTTCACCAAATCTTCCTTCAGCCCTTTTGTTGTTAACT
JMFF003A20+ TGCGAAGTGCTTCATCCAACCGCTTCACCAAATCTTCCTTCAGCCCTTTTGTTGTTAACT
JMFS040A06+ TGCGAAGTGCTTCATCCAACCGCTTCACCAAATCTTCCTTCAGCCCTTTTGTTGTTAACT
                      ____________________________________________________________
consensus TGCGAAGTGCTTCATCCAACCGCTTCACCAAATCTTCCTTCAGCCCTTTTGTTGTTAACT
 
. : . : . : . : . : . :
JMFS072G01+ TGCGTCTCTTAAGCTCTTCCTTTAGCTCTGTGACTTTCCACTGATCAATCGGTCGACTGT
JMFS122E12+ TGCGTCTCTTAAGCTCTTCCTTTAGCTCTGTGACTTTCCACTGATCAATCGGTCGACTGT
JMFF003A20+ TGCGTCTCTTAAGCTCTTCCTTTAGCTCTGTGACTTTCCACTGATCAATCGGTCGACTGT
JMFS040A06+ TGCGTCTCTTAAGCTCTTCCTTTAGCTCTGTGACTTTCCACTGATCAATCGGTCGACTGT
                      ____________________________________________________________
consensus TGCGTCTCTTAAGCTCTTCCTTTAGCTCTGTGACTTTCCACTGATCAATCGGTCGACTGT
 
. : . : . : . : . : . :
JMFS072G01+ CCAGAATAGGATATGGGGATGACATTTGTTTGTCCAAAATCCACACTTAAAATTGACTGG
JMFS122E12+ CCAGAATAGGATATGGGGATGACATTTGTTTGTCCAAAATCCACACTTAAAATTGACTGG
JMFF003A20+ CCAGAATAGGATATGGGGATGACATTTGTTTGTCCAAAATCCACACTTAAAATTGACTGG
JMFS040A06+ CCAGAATAGGATATGGGGATGACATTTGTTTGTCCAAAATCCACACTTAAAATTGACTGG
                      ____________________________________________________________
consensus CCAGAATAGGATATGGGGATGACATTTGTTTGTCCAAAATCCACACTTAAAATTGACTGG
 
. : . : . : . : . : . :
JMFS072G01+ TAAGGATTTGGTTCAATGCTGGAATAGCTGTGATCACAGATGTCAGTTTCCACAGTTACA
JMFS122E12+ TAAGGATTTGGTTCAATGCTGGAATAGCTGTGATCACAGATGTCAGTTTCCACAGTTACA
JMFF003A20+ TAAGGATTTGGTTCAATGCTGGAATAGCTGTGATCACAGATGTCAGTTTCCACAGTTACA
JMFS040A06+ TAAGGATTTGGTTCAATGCTGGAATAGCTGTGATCACAGATGTCAGTTTCCACAGTTACA
                      ____________________________________________________________
consensus TAAGGATTTGGTTCAATGCTGGAATAGCTGTGATCACAGATGTCAGTTTCCACAGTTACA
 
. : . : . : . : . : . :
JMFS072G01+ AGAAACGTGTGGAGACAGCAAGCCCTAGCTTCACCATAACACAAACACAACTATCAGCAG
JMFS122E12+ AGAAACGTGTGGAGACAGCAAGCCCTAGCTTCACCATAACACAAACACAACTATCAGCAG
JMFF003A20+ AGAAACGTGTGGAGACAGCAAGCCCTAGCTTCACCATAACACAAACACAACTATCAGCAG
JMFS040A06+ AGAAACGTGTGGAGACAGCAAGCCCTAGCTTCACCATAACACAAACACAACTATCAGCAG
                      ____________________________________________________________
consensus AGAAACGTGTGGAGACAGCAAGCCCTAGCTTCACCATAACACAAACACAACTATCAGCAG
 
. : . : . : . : . : . :
JMFS072G01+ AATTTAACAAAAATCAAACAAATGAAAACAAGATTCAAAAGAAAAATCTGGAAAATGTAA
JMFS122E12+ AATTTAACAAAAATCAAACAAATGAAAACAAGATTCAAAAGAAAAATCTGGAAAATGTAA
JMFF003A20+ AATTTAACAAAAATCAAACAAATGAAAACAAGATTCAAAAGAAAAATCTGGAAAATGTAA
JMFS040A06+ AATTTAACAAAAATCAAACAAATGAAAACAAGATTCAAAAGAAAAATCTGGAAAATGTAA
                      ____________________________________________________________
consensus AATTTAACAAAAATCAAACAAATGAAAACAAGATTCAAAAGAAAAATCTGGAAAATGTAA
 
. : . : . : . : . : . :
JMFS072G01+ AGTGAGAGCAAAAAATAGCGGTCCGATTAGGGTTTTGGGTAG
JMFS122E12+ AGTGAGAGCAAAAAATAGCGGTCCGATTAGGGTTTTGGGTAG
JMFF003A20+ AGTGAGAGCAAAAAATAGCGGTCCGATTAGGGTTTTGGGTAG
JMFS040A06+ AGTGAGAGCAAAAAATAGCGGTCCGATTAGGGTTTTGGGTAGTGCTTCTGCCTGCAGCCC
                      ____________________________________________________________
consensus AGTGAGAGCAAAAAATAGCGGTCCGATTAGGGTTTTGGGTAGTGCTTCTGCCTGCAGCCC