Previous Contig 003179:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS039H04Sequence662003179 (2)gb:AC090485_17343143e-58Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from
JMFS075C08Sequence627003179 (2)gb:AC090485_17343143e-58Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS039H04+ AGT
                      ____________________________________________________________
consensus AGT
 
. : . : . : . : . : . :
JMFS075C08+ CTATACTGCCAGCAGGCCTGACACCAACATTTAAATGCATTTGCAAAG
JMFS039H04+ GAGAAATCCACGCTATACTGCCAGCAGGCCTGACACCAACATTTAAATGCATTTGCAAAG
                      ____________________________________________________________
consensus GAGAAATCCACGCTATACTGCCAGCAGGCCTGACACCAACATTTAAATGCATTTGCAAAG
 
. : . : . : . : . : . :
JMFS075C08+ ATTGGCCTGTATATTTCTCTCACATTCCCAAGAATGGGTACGACTCGTGCAAGAACACCT
JMFS039H04+ ATTGGCCTGTATATTTCTCTCACATTCCCAAGAATGGGTACGACTCGTGCAAGAACACCT
                      ____________________________________________________________
consensus ATTGGCCTGTATATTTCTCTCACATTCCCAAGAATGGGTACGACTCGTGCAAGAACACCT
 
. : . : . : . : . : . :
JMFS075C08+ TTTAATCGTGGAGTAAACTGCAAAGCATCAGATGATGCATAGTCTGCAAGTATTTGAACC
JMFS039H04+ TTTAATCGTGGAGTAAACTGCAAAGCATCAGATGATGCATAGTCTGCAAGTATTTGAACC
                      ____________________________________________________________
consensus TTTAATCGTGGAGTAAACTGCAAAGCATCAGATGATGCATAGTCTGCAAGTATTTGAACC
 
. : . : . : . : . : . :
JMFS075C08+ ATTGCAGGTAGAGCTGAATTTGAACCAGAGAAATGGAGAAATATTTCTTCCATCATTAGA
JMFS039H04+ ATTGCAGGTAGAGCTGAATTTGAACCAGAGAAATGGAGAAATATTTCTTCCATCATTAGA
                      ____________________________________________________________
consensus ATTGCAGGTAGAGCTGAATTTGAACCAGAGAAATGGAGAAATATTTCTTCCATCATTAGA
 
. : . : . : . : . : . :
JMFS075C08+ TCAGGAAGATGTGAACCAACTGATACGAGGACACCAGCAGCAGCTCTTTGCCAATCAGCA
JMFS039H04+ TCAGGAAGATGTGAACCAACTGATACGAGGACACCAGCAGCAGCTCTTTGCCAATCAGCA
                      ____________________________________________________________
consensus TCAGGAAGATGTGAACCAACTGATACGAGGACACCAGCAGCAGCTCTTTGCCAATCAGCA
 
. : . : . : . : . : . :
JMFS075C08+ TTCAATTCCTTTGTTGAAATGACCTCAGCTGTTGCAATCTTGGCAAGCTTCATCATGAAA
JMFS039H04+ TTCAATTCCTTTGTTGAAATGACCTCAGCTGTTGCAATCTTGGCAAGCTTCATCATGAAA
                      ____________________________________________________________
consensus TTCAATTCCTTTGTTGAAATGACCTCAGCTGTTGCAATCTTGGCAAGCTTCATCATGAAA
 
. : . : . : . : . : . :
JMFS075C08+ GCAGGATCTACATCCCCCTTATCCAAGGCACGAATTGCCACGGATATTACTTGAAATAAA
JMFS039H04+ GCAGGATCTACATCCCCCTTATCCAAGGCACGAATTGCCACGGATATTACTTGAAATAAA
                      ____________________________________________________________
consensus GCAGGATCTACATCCCCCTTATCCAAGGCACGAATTGCCACGGATATTACTTGAAATAAA
 
. : . : . : . : . : . :
JMFS075C08+ CCAGCTATATTCCCAAACCTCCGGCGTCCACCTCTAGAAACAGTTAGGCAGCAATCAAGA
JMFS039H04+ CCAGCTATATTCCCAAACCTCCGGCGTCCACCTCTAGAAACAGTTAGGCAGCAATCAAGA
                      ____________________________________________________________
consensus CCAGCTATATTCCCAAACCTCCGGCGTCCACCTCTAGAAACAGTTAGGCAGCAATCAAGA
 
. : . : . : . : . : . :
JMFS075C08+ ACCAGAAGTGGGTTCAAGGAAGTAATATCCTTGAGAGCAGACATGGAGGCTTCTCTGACC
JMFS039H04+ ACCAGAAGTGGGTTCAAGGAAGTAATATCCTTGAGAGCAGACATGGAGGCTTCTCTGACC
                      ____________________________________________________________
consensus ACCAGAAGTGGGTTCAAGGAAGTAATATCCTTGAGAGCAGACATGGAGGCTTCTCTGACC
 
. : . : . : . : . : . :
JMFS075C08+ GAGGGAGAGTCATCAGCTAAAGATGAGACCATAACTTGAACTGCCTCGGAAGCAGGAATG
JMFS039H04+ GAGGGAGAGTCATCAGCTAAAGATGAGACCATAACTTGAACTGCCTCGGAAGCAGGAATG
                      ____________________________________________________________
consensus GAGGGAGAGTCATCAGCTAAAGATGAGACCATAACTTGAACTGCCTCGGAAGCAGGAATG
 
. : . : . : . : . : . :
JMFS075C08+ GAGTCACCGGAGCTAGAAGCAGCCATGAATTGGAAGGAA
JMFS039H04+ GAGTCACCGGAGCTAGAAGCAGCCAT-AATTGGAAGGAAGAAGACCGATCACCGGAGAAG
                      ____________________________________________________________
consensus GAGTCACCGGAGCTAGAAGCAGCCATGAATTGGAAGGAAGAAGACCGATCACCGGAGAAG