Previous Contig 003177:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS039G08Sequence617003177 (4)
JMSF004O13Sequence240003177 (4)319001807 (126)gb:A57643_14498182e-10Sequence 1 from Patent WO9632488.
JMSF005B18Sequence239003177 (4)420002414 (8)gb:AC119292_17397051e-10Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0088F07, complet
JMSF035A14Sequence703003177 (4)gb:AY640382_16189796e-17Nicotiana tabacum NIM1-like protein 1 (NML1) mRNA, complete cds.764012960 (2)gb:AY640382_16189794e-89Nicotiana tabacum NIM1-like protein 1 (NML1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035A14+ CTAAACAGCACATGAAAAAAGTTACTCCTAGCGGCTAAT
                      ____________________________________________________________
consensus CTAAACAGCACATGAAAAAAGTTACTCCTAGCGGCTAAT
 
. : . : . : . : . : . :
JMSF035A14+ ATACACCGGTGGACACCAACCGTAGTCCCCTCTACAACAATATCAGCATCACTAAAATCT
                      ____________________________________________________________
consensus ATACACCGGTGGACACCAACCGTAGTCCCCTCTACAACAATATCAGCATCACTAAAATCT
 
. : . : . : . : . : . :
JMSF035A14+ GAAGTTGTATCAGACAAGAGTTGTTCCAAACTATTGCTGAGCTTACTTAAACTGAAAATC
                      ____________________________________________________________
consensus GAAGTTGTATCAGACAAGAGTTGTTCCAAACTATTGCTGAGCTTACTTAAACTGAAAATC
 
. : . : . : . : . : . :
JMSF035A14+ TCGAGACTAGATCCACCCGAAGATGGCACAATCTGCCCAATCGACCCATTCGATGTCTGT
JMFS039G08+ GACCCATTCGATGTCTGT
                      ____________________________________________________________
consensus TCGAGACTAGATCCACCCGAAGATGGCACAATCTGCCCAATCGACCCATTCGATGTCTGT
 
. : . : . : . : . : . :
JMSF035A14+ GATGATGAAGTGAAACTTATGGATGATGATGGTTCAAAAGAACTACCCATATCTCCTCCA
JMFS039G08+ GATGATGAAGTGAAACTTATGGATGATGATGGTTCAAAAGAACTACCCATATCTCCTCCA
                      ____________________________________________________________
consensus GATGATGAAGTGAAACTTATGGATGATGATGGTTCAAAAGAACTACCCATATCTCCTCCA
 
. : . : . : . : . : . :
JMSF035A14+ ATCCTATATCAGTAAATTCAATTTCCTTTTCCTTTTCCTTTTCCTATTCCTATTCCTATT
JMFS039G08+ ATCCTATATCAGTAAATTCAATTTCCTTTTCCTTTTCCTTTTCCTATTCCTATTCCTATT
                      ____________________________________________________________
consensus ATCCTATATCAGTAAATTCAATTTCCTTTTCCTTTTCCTTTTCCTATTCCTATTCCTATT
 
. : . : . : . : . : . :
JMSF035A14+ CTTTACAGTATCAATGCCATCCTCAATATATGCTCAATCAACACCTAATTCTACTTCAGA
JMFS039G08+ CTTTACAGTATCAATGCCATCCTCAATATATGCTCAATCAACACCTAATTCTACTTCAGA
                      ____________________________________________________________
consensus CTTTACAGTATCAATGCCATCCTCAATATATGCTCAATCAACACCTAATTCTACTTCAGA
 
. : . : . : . : . : . :
JMSF035A14+ ATTTCTGGCCTTACATGATTGATAGAAAAAATTTCAAGAAACAAAATCAACCCATCAGAG
JMFS039G08+ ATTTCTGGCCTTACATGATTGATAGAAAAAATTTCAAGAAACAAAATCAACCCATCAGAG
                      ____________________________________________________________
consensus ATTTCTGGCCTTACATGATTGATAGAAAAAATTTCAAGAAACAAAATCAACCCATCAGAG
 
. : . : . : . : . : . :
JMSF035A14+ CTTTAAACTAACATGAATGAATTATGAATCCCTTATCCAGTAATCTTTCAAAATACATAT
JMSF005B18+ CCAGTANTCTTTCAAAATACATAT
JMSF004O13+ CCAGTAATCTTTCAAAATACATAT
JMFS039G08+ CTTTAAACTAACATGAATGAATTATGAATCCCTTATCCAGTAATCTTTCAAAATACATAT
                      ____________________________________________________________
consensus CTTTAAACTAACATGAATGAATTATGAATCCCTTATCCAGTAATCTTTCAAAATACATAT
 
. : . : . : . : . : . :
JMSF035A14+ ATAAACACACAGCAAGATTTACAACATACTCTGCAAG-AAACAGAAACCCACGACAGCAG
JMSF005B18+ ATAAACACACAGCAAGATTTACAACATACTCTGCAAG-AAACAGAAACCCACGACAGCAG
JMSF004O13+ ATAAACACACAGCAAGATTTACAACATACTCTGCAAGAAAACAGAAACCCACGACAGCAG
JMFS039G08+ ATAAACACACAGCAAGATTTACAACATACTCTGCAAG-AAACAGAAACCCACGACAGCAG
                      ____________________________________________________________
consensus ATAAACACACAGCAAGATTTACAACATACTCTGCAAG-AAACAGAAACCCACGACAGCAG
 
. : . : . : . : . : . :
JMSF035A14+ ATCCAAAAGGCCAAGACTTGAACTGGGAGAAGGTGAAACTGATCAAAACAATAAAATTAA
JMSF005B18+ ATCCAAAAGGCCAAGACTTGAACTGGGAGAAGGTGAAACTGATCAAAACAATAAAATTAA
JMSF004O13+ ATCCAAAAGGCCAAGACTTGAACTGGGAGAAGGTGAAACTGATCAAAACAATAAAATTAA
JMFS039G08+ ATCCAAAAGGCCAAGACTTGAACTGGGAGAAGGTGAAACTGATCAAAACAATAAAATTAA
                      ____________________________________________________________
consensus ATCCAAAAGGCCAAGACTTGAACTGGGAGAAGGTGAAACTGATCAAAACAATAAAATTAA
 
. : . : . : . : . : . :
JMSF035A14+ TACCCAGTAATTGCTTTCAATTTCAAAGCAGGCTAGAACATCTGTCTTTGCCAAGATCAA
JMSF005B18+ TACCCAGTAATTGCTTTCAATTTCAAAGCAGGCTAGAACATCTGTCTTTGCCAAGATCAA
JMSF004O13+ TACCCAGTAATTGCTTTCAATTTCAAAGCAGGCTAGAACATCTGTCTTTGCCAAGATCAA
JMFS039G08+ TACCCAGTAATTGCTTTCAATTTCAAAGCAGGCTAGAACATCTGTCTTTGCCAAGATCAA
                      ____________________________________________________________
consensus TACCCAGTAATTGCTTTCAATTTCAAAGCAGGCTAGAACATCTGTCTTTGCCAAGATCAA
 
. : . : . : . : . : . :
JMSF035A14+ ACAG
JMSF005B18+ ACAGAACCCAAACCCATCAAAGATTAGAGCTT
JMSF004O13+ ACAGAACCCAAACCCATCAAAGATTAGAGCTT
JMFS039G08+ ACAGAACCCAAACCCATCAAAGATTAGAGCTTGGAAATAAAGGAAAAAATTTAGCTGCCG
                      ____________________________________________________________
consensus ACAGAACCCAAACCCATCAAAGATTAGAGCTTGGAAATAAAGGAAAAAATTTAGCTGCCG
 
. : . : . : . : . : . :
JMFS039G08+ CCGCTACTATGAGTCGAAAACGGACAAAGATCGGCCCCACTTGTCCCCTGGGAAGTTTCG
                      ____________________________________________________________
consensus CCGCTACTATGAGTCGAAAACGGACAAAGATCGGCCCCACTTGTCCCCTGGGAAGTTTCG