Previous Contig 003170:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS020F07Sequence616003170 (4)gb:AY171099_15867357e-31Gossypium hirsutum cysteine protease mRNA, complete cds.
JMFS039B03Sequence614003170 (4)gb:AY171099_15867353e-25Gossypium hirsutum cysteine protease mRNA, complete cds.
JMFS099E07Sequence446003170 (4)gb:AY171099_15867357e-18Gossypium hirsutum cysteine protease mRNA, complete cds.
JMFS121D07Sequence287003170 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS020F07+ TTGATCCTTAACACGAGTGACGGCCCC
JMFS039B03+ ACGAGTGACGGCCCC
                      ____________________________________________________________
consensus TTGATCCTTAACACGAGTGACGGCCCC
 
. : . : . : . : . : . :
JMFS020F07+ ACGCTTTCGCCAATCGACAGAGAAGGGGGCTTCACAAGACACCTTCTTCTTCTTCTCCCT
JMFS039B03+ ACGCTTTCGCCAATCGACAGAGAAGGGGGCTTCACAAGACACC-TCTTCTTCTTCTCCCT
                      ____________________________________________________________
consensus ACGCTTTCGCCAATCGACAGAGAAGGGGGCTTCACAAGACACCTTCTTCTTCTTCTCCCT
 
. : . : . : . : . : . :
JMFS020F07+ GCCACTATGCACTGCAGACACCATCTGAATCCCTTGCTTCTTCCTAAAGGGCATCTTAAT
JMFS039B03+ GCCACTCTGCACTGCAGACACCATCTGAATCCCTTGCTTCTTCCTAAAGGGCATCTTAAT
                      ____________________________________________________________
consensus GCCACTCTGCACTGCAGACACCATCTGAATCCCTTGCTTCTTCCTAAAGGGCATCTTAAT
 
. : . : . : . : . : . :
JMFS020F07+ CTTGGATGTGAAAACATCCTTAAACTCCTCATTCCTCAAATCAGCAAACTTGTTTAACCC
JMFS099E07+ CCTCATTCCTGGAATCAGCAAACTTGTTTAACCC
JMFS039B03+ CTTGGATGTGAAAACATCCTTAAACTCCTCATTCCTCAAATCAGCAAACTTGTTTAACCC
                      ____________________________________________________________
consensus CTTGGATGTGAAAACATCCTTAAACTCCTCATTCCTCAAATCAGCAAACTTGTTTAACCC
 
. : . : . : . : . : . :
JMFS020F07+ AACTTTACCCTCCCACCTCGACCCTCTCCCCCCCACTGTCTTCTCCTTAACATACTTGAG
JMFS099E07+ AACTTTACCCTCCCACCTCGACCCTCTCCCCCCCACTGTCTTCTCCTTAACATACTTGAG
JMFS039B03+ AACTTTACCCTCCCACCTCGACCCTCTCCCCCCCACTGTCTTCTCCTTAACATACTTGAG
                      ____________________________________________________________
consensus AACTTTACCCTCCCACCTCGACCCTCTCCCCCCCACTGTCTTCTCCTTAACATACTTGAG
 
. : . : . : . : . : . :
JMFS020F07+ ATTCCCTTTGAAGTTCTGAAACCTCTCTTCATACTCCTCCTCATCCCTGTACACCTTCCC
JMFS099E07+ ATTCCCTTTGAAGTTCTGAAACCTCTCTTCATACTCCTCCTCATCCCTGTACACCTTCCC
JMFS039B03+ ATTCCCTTTGAAGTTCTGAAACCTCTCTTCATACTCCTCCTCATCCCTGTACACCTTCCC
                      ____________________________________________________________
consensus ATTCCCTTTGAAGTTCTGAAACCTCTCTTCATACTCCTCCTCATCCCTGTACACCTTCCC
 
. : . : . : . : . : . :
JMFS020F07+ GTTCCTCTCCTTCCACTCCTCGAACAGCCGGAGCACCTTCTCCTCCGGGACGAACCCGCC
JMFS099E07+ GTTCCTCTCCTTCCACTCCTCGAACAGCCGGAGCACCTTCTCCTCCGGGACGAACCCGCC
JMFS121D07+ CCACTCCTCGAACAGCCGGAGCACCTTCTCCTCCGGGACGAACCCGCC
JMFS039B03+ GTTCCTCTCCTTCCACTCCTCGAACAGCCGGAGCACCTTCTCCTCCGGGACGAACCCGCC
                      ____________________________________________________________
consensus GTTCCTCTCCTTCCACTCCTCGAACAGCCGGAGCACCTTCTCCTCCGGGACGAACCCGCC
 
. : . : . : . : . : . :
JMFS020F07+ GCCGGCGCCGGCGATGGCGAACCCGTCATAGTAACAAGAAACCCCGCCGCACCAGACCGC
JMFS099E07+ GCCGGCGCCGGCGATGGCGAACCCGTCATAGTAACAAGAAACCCCGCCGCACCAGACCGC
JMFS121D07+ GCCGGCGCCGGCGATGGCGAACCCGTCATAGTAACAAGAAACCCCGCCGCACCAGACCGC
JMFS039B03+ GCCGGCGCCGGCGATGGCGAACCCGTCATAGTAACAAGAAACCCCGCCGCACCAGACCGC
                      ____________________________________________________________
consensus GCCGGCGCCGGCGATGGCGAACCCGTCATAGTAACAAGAAACCCCGCCGCACCAGACCGC
 
. : . : . : . : . : . :
JMFS020F07+ GGCTACGATCAAGAAAACAAGAAACCCGCAGCCCTGCAGGGAGCATTTGGTTCCCATTTA
JMFS099E07+ GGCTACGATCAAGAAAACAAGAAACCCGCAGCCCTGCAGGGAGCATTTGGTTCCCATTTA
JMFS121D07+ GGCTACGATCAAGAAAACAAGAAACCCGCAGCCCTGCAGGGAGCATTTGGTTCCCATTTA
JMFS039B03+ GGCTACGATCAAGAAAACAAGAAACCCGCAGCCCTGCAGGGAGCATTTGGTTCCCATTTA
                      ____________________________________________________________
consensus GGCTACGATCAAGAAAACAAGAAACCCGCAGCCCTGCAGGGAGCATTTGGTTCCCATTTA
 
. : . : . : . : . : . :
JMFS020F07+ CTCGCCGCATTAAACAATCAGTGATATGATTGCTGCTTACAGTCGCCGGAGGCCGGGGCT
JMFS099E07+ CTCGCCGCATTAAACAATCAGTGATATGATTGCTGCTTACAGTCGCCGGAGGCCGGGGCT
JMFS121D07+ CTCGCCGCATTAAACAATCAGTGATATGATTGCTGCTTACAGTCGCCGGAGGCCGGGGCT
JMFS039B03+ CTCGCCGCATTAAACAATCAGTGATATGATTGCTGCTTACAGTCGCCGGAGGCCGGGGCT
                      ____________________________________________________________
consensus CTCGCCGCATTAAACAATCAGTGATATGATTGCTGCTTACAGTCGCCGGAGGCCGGGGCT
 
. : . : . : . : . : . :
JMFS020F07+ TTGCATGTCCAAAAACTCTTCGCCGGCGCTGTAAATACACTCTTTTTTC
JMFS099E07+ TTGCATGTCCAAAAACTCTTCGCCGGCGCTGTAAATACACTCTTTTTTC
JMFS121D07+ TTGCATGTCCAAAAACTCTTCGCCGGCGCTGTAAATACACTCTTTTTTCGGT
JMFS039B03+ TTGCATGTCCAAAAACTCTTCGCCGGCGCTGTAAATACACTCTTTTTTCGGTGAGTTGAC
                      ____________________________________________________________
consensus TTGCATGTCCAAAAACTCTTCGCCGGCGCTGTAAATACACTCTTTTTTCGGTGAGTTGAC