Previous Contig 003156:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS036E04Sequence615003156 (3)gb:AF302666_17843172e-70Arabidopsis thaliana ubiquitin-specific protease 16 (UBP16) mRNA, complete cds.
JMFS039D02Sequence646003156 (3)gb:AF302666_17843175e-76Arabidopsis thaliana ubiquitin-specific protease 16 (UBP16) mRNA, complete cds.
JMFS045E12Sequence555003156 (3)gb:AF302666_17843172e-66Arabidopsis thaliana ubiquitin-specific protease 16 (UBP16) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS045E12+ ATTGGTGACTTGTCGCTCGTTCCACTCA
JMFS039D02+ ACTCCATAGAGCTGGTAAATTGGTGACTTGTCGCTCGTTCCACTCA
JMFS036E04+ CGCTCGTTCCACTCA
                      ____________________________________________________________
consensus ACTCCATAGAGCTGGTAAATTGGTGACTTGTCGCTCGTTCCACTCA
 
. : . : . : . : . : . :
JMFS045E12+ TGTATGGGGCCAAATTCAGAATTTCAGGAAATGTTACCGGCTTATTCAGCTTGCCAAATT
JMFS039D02+ TGTATGGGGCCAAATTCAGAATTTCAGGAAATGTTACCGGCTTATTCAGCTTGCCAAATT
JMFS036E04+ TGTATGGGGCCAATTTCAGAATTTCAGGAAATGTAACCGGCCTATTCAGCTTGCCAAATT
                      ____________________________________________________________
consensus TGTATGGGGCCAAATTCAGAATTTCAGGAAATGTTACCGGCTTATTCAGCTTGCCAAATT
 
. : . : . : . : . : . :
JMFS045E12+ TACCTGACTGATATCTCTTCAAGGTAATAGTAAGGACATTAGGGGCCTCCAGCACTTTCA
JMFS039D02+ TACCTGACTGATATCTCTTCAAGGTAATAGTAAGGACATTAGGGGCCTCCAGCACTTTCA
JMFS036E04+ TACCTGACTGATATCTCTTCAAGGTAATAGTAAGGACATTAGGGGCCTCCAGCACTTTCA
                      ____________________________________________________________
consensus TACCTGACTGATATCTCTTCAAGGTAATAGTAAGGACATTAGGGGCCTCCAGCACTTTCA
 
. : . : . : . : . : . :
JMFS045E12+ TCTTCTTTCTAGCCTTTTCATAGGATTTGCATCTGCTGCAGTGGTACTTGTTTTCACCAT
JMFS039D02+ TCTTCTTTCTAGCCTTTTCATAGGATTTGCATCTGCTGCAGTGGTACTTGTTTTCACCAT
JMFS036E04+ TCTTCTTTCTAGCCTTTTCATAGGATTTGCATCTGCTGCAGAGTTACTTGTTTTCACCAT
                      ____________________________________________________________
consensus TCTTCTTTCTAGCCTTTTCATAGGATTTGCATCTGCTGCAGTGGTACTTGTTTTCACCAT
 
. : . : . : . : . : . :
JMFS045E12+ CTAACACCTCAGTGCGTGAGAATTGTTTTAGAGCCTCTTCCAGAGTTACAACATCTCCAT
JMFS039D02+ CTAACACCTCAGTGCGTGAGAATTGTTTTAGAGCCTCTTCCAGAGTTACAACATCTCCAT
JMFS036E04+ CTAACACCTCAGTGCGTGAGAATTGTTTTAGAGCCTCTTCCAGAGTTACAACATCTCCAT
                      ____________________________________________________________
consensus CTAACACCTCAGTGCGTGAGAATTGTTTTAGAGCCTCTTCCAGAGTTACAACATCTCCAT
 
. : . : . : . : . : . :
JMFS045E12+ ATATCTCAACTATAAGGTCCATCATTTTTTCATGCTTCTCAGATTTGCCTCCACACCTCA
JMFS039D02+ ATATCTCAACTATAAGGTCCATCATTCTTTCATGCTTCTCAGATTTGCCTCCACACCTCA
JMFS036E04+ ATATCTCAACTATAAGGTCCATCATTCTTTCATGCTTCTCAGATTTGCCTCCACACCTCA
                      ____________________________________________________________
consensus ATATCTCAACTATAAGGTCCATCATTCTTTCATGCTTCTCAGATTTGCCTCCACACCTCA
 
. : . : . : . : . : . :
JMFS045E12+ TGCACTCAATCTTTGAGCGGAGACAGCCTCCAAATGTAAGCCCAATTAGAGTTGTTTCCT
JMFS039D02+ TGCACTCAATCTTTGAGCGGAGACAGCCTCCAAATGTAAGCCCAATTAGAGTTGTTTCCT
JMFS036E04+ TGCACTCAATCTTTGAGCGGAGACAGCCTCCAAATGTAAGCCCAATTAGAGTTGTTTCCT
                      ____________________________________________________________
consensus TGCACTCAATCTTTGAGCGGAGACAGCCTCCAAATGTAAGCCCAATTAGAGTTGTTTCCT
 
. : . : . : . : . : . :
JMFS045E12+ CTTCCAAAGATCCTGATACAGTGACTCCTACTTCCTTCAAGCAAACAGATTGCATGGTGT
JMFS039D02+ CTTCCAAAGATCCTGATACAGTGACTCCTACTTCCTTCAAGCAAACAGATTGCATGGTGT
JMFS036E04+ CTTCCAAAGATCCTGATACAGTGACTCCTACTTCCTTCAAGCAAACAGATTGCATGGTGT
                      ____________________________________________________________
consensus CTTCCAAAGATCCTGATACAGTGACTCCTACTTCCTTCAAGCAAACAGATTGCATGGTGT
 
. : . : . : . : . : . :
JMFS045E12+ CAATGACATACCTGAGAAACTCATGAGCATCTTCTTCTTGCCCATTACCAAGATTGCTCC
JMFS039D02+ CAATGACATACCTGAGAAACTCATGAGCATCTTCTTCTTGCCCATTACCAAGATTGCTCC
JMFS036E04+ CAATGACATACCTGAGAAACTCATGAGCATCTTCTTCTTGCCCATTACCAAGATTGCTCC
                      ____________________________________________________________
consensus CAATGACATACCTGAGAAACTCATGAGCATCTTCTTCTTGCCCATTACCAAGATTGCTCC
 
. : . : . : . : . : . :
JMFS045E12+ CAATGTTCTCCAAATGGGAAACTATTCGGATTGGGGAGAGTGGAGAA
JMFS039D02+ CAATGTTCTCCAAATGGGAAACTATTCGGATTGGGGAGAGTGGAGAATTTCCCTCCTTTG
JMFS036E04+ CAATGTTCTCCAAATGGGAAACTATTCGGATTGGGGAGAGTGGAGAATTTCCCTCCTTTG
                      ____________________________________________________________
consensus CAATGTTCTCCAAATGGGAAACTATTCGGATTGGGGAGAGTGGAGAATTTCCCTCCTTTG
 
. : . : . : . : . : . :
JMFS039D02+ CTTTTAGAACTAAACTCTCTAATTCACAGGTGAAGCACCATCCTTCCTTCCTGCATCCTT
JMFS036E04+ CTTTTAGAACTAAACTCTCTAATTCACAGGTGAAGCACCATCCTTCCTTCCTGCATCCTT
                      ____________________________________________________________
consensus CTTTTAGAACTAAACTCTCTAATTCACAGGTGAAGCACCATCCTTCCTTCCTGCATCCTT