Previous Contig 003148:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS035C11Sequence612003148 (3)
JMFS066A10Sequence620003148 (3)
JMFS078H03Sequence600003148 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS078H03+ GGTGGAGCTCCCCGT
                      ____________________________________________________________
consensus GGTGGAGCTCCCCGT
 
. : . : . : . : . : . :
JMFS078H03+ GAAGGTGGTAGTGGAGGCGGTGGAGGAGGTGAAGTACCAAGTGAAGGTAATGGGGGAGGA
                      ____________________________________________________________
consensus GAAGGTGGTAGTGGAGGCGGTGGAGGAGGTGAAGTACCAAGTGAAGGTAATGGGGGAGGA
 
. : . : . : . : . : . :
JMFS078H03+ AGAGGGGGTGACATTGGAGCACCATGTGAAAGTGGTGGGGGGGGAGGAGGTGGCGGTGGT
                      ____________________________________________________________
consensus AGAGGGGGTGACATTGGAGCACCATGTGAAAGTGGTGGGGGGGGAGGAGGTGGCGGTGGT
 
. : . : . : . : . : . :
JMFS078H03+ GGTGGTGGACAACTTTGTGAAGGCAGCGGTGGGGGAGGTGGAACACCCTGTAAAGTTGAT
                      ____________________________________________________________
consensus GGTGGTGGACAACTTTGTGAAGGCAGCGGTGGGGGAGGTGGAACACCCTGTAAAGTTGAT
 
. : . : . : . : . : . :
JMFS078H03+ GGGAAATTTGCAGGACCTGACACAAACAAAGGAGTACTTCTAAACATAGGAGGAGGAGGA
JMFS066A10+ CAAACAAAGGAGTACTTCTAAACATAGTAGTAGNAGGA
                      ____________________________________________________________
consensus GGGAAATTTGCAGGACCTGACACAAACAAAGGAGTACTTCTAAACATAGTAGTAGGAGGA
 
. : . : . : . : . : . :
JMFS078H03+ GGAGGTGGTGGAGGTGGAGGAGGGGCAGTAGGTGGTGGATATGAAGGTCCTCCAACACTA
JMFS066A10+ GNAGGTGGTGGAGGTGGAGGAGGGGCAGTAGGTGGTGGATATGAAGGTCCTCCAACACTA
JMFS035C11+ TCCTCCAACACTA
                      ____________________________________________________________
consensus GGAGGTGGTGGAGGTGGAGGAGGGGCAGTAGGTGGTGGATATGAAGGTCCTCCAACACTA
 
. : . : . : . : . : . :
JMFS078H03+ GCAGATTTAACTGTAGATGCTGCAGATGGTGGAGGAGGGGGCGGTGGTGGAATTGGCACA
JMFS066A10+ GCAGATTTAACTGTAGATGCTGCAGATGGTGGAGGAGGGGGCGGTGGTGGAATTGGCACA
JMFS035C11+ GCAGATTTAACTGTAGATGCTGCAGATGGTGGAGGAGGGGGCGGTGGTGGAATTGGCACA
                      ____________________________________________________________
consensus GCAGATTTAACTGTAGATGCTGCAGATGGTGGAGGAGGGGGCGGTGGTGGAATTGGCACA
 
. : . : . : . : . : . :
JMFS078H03+ GACTTAGGCAGTGCCACAGAAGAAGCTACATTAGCCCAGCTTGTTGAGGTAGTGGGTGCA
JMFS066A10+ GACTTAGGCAGTGCCACAGAAGAAGCTACATTAGCCCAGCTTGTTGAGGTAGTGGGTGCA
JMFS035C11+ GACTTAGGCAGTGCCACAGAAGAAGCTACATTAGCCCAGCTTGTTGAGGTAGTGGGTGCA
                      ____________________________________________________________
consensus GACTTAGGCAGTGCCACAGAAGAAGCTACATTAGCCCAGCTTGTTGAGGTAGTGGGTGCA
 
. : . : . : . : . : . :
JMFS078H03+ GGTGGTGGAGGAGGAGGAGGTGATGATGAAGTAGAGACAGCAATGCGTGTAGAAAACAGG
JMFS066A10+ GGTGGTGGAGGAGGAGGAGGTGATGATGAAGTAGAGACAACAATGCGTGTAGAAAACAGG
JMFS035C11+ GGTGGTGGAGGAGCAGGAGGTGATGATGAAGTAGAGCCAACAATGCGTGTAGAAAACAGG
                      ____________________________________________________________
consensus GGTGGTGGAGGAGGAGGAGGTGATGATGAAGTAGAGACAACAATGCGTGTAGAAAACAGG
 
. : . : . : . : . : . :
JMFS078H03+ GGCAAGGGAGGTGGAGGGGGTGGTGGAGGAGGAGGATGACTATTGGTAGAAACTGTTACG
JMFS066A10+ GGCAAGGGAGGTGGAGGGGGTGGTGGAGGAGGAGGATGACTATTGGTAGAAACTGTTACG
JMFS035C11+ GGCAAGGCAGGTGTAGTGGGTGGTGGAGTAGGAGGATGACTATTGGTAGAAACTGTTACG
                      ____________________________________________________________
consensus GGCAAGGGAGGTGGAGGGGGTGGTGGAGGAGGAGGATGACTATTGGTAGAAACTGTTACG
 
. : . : . : . : . : . :
JMFS078H03+ CTGTGGCTTTCTTGTTGAGGCAGAATATAGATGTGGAGAAGATGC
JMFS066A10+ CTGTGGCTTTCTTGTTGAGGCA-AATATAGATGTGGAGAAGATGCTGAGACACCACTCCC
JMFS035C11+ CTGTGGCTTTCTTGTTGAGGCA-AATATAGATGTGGAGAAGATGCTGAGACACCACTCCC
                      ____________________________________________________________
consensus CTGTGGCTTTCTTGTTGAGGCA-AATATAGATGTGGAGAAGATGCTGAGACACCACTCCC
 
. : . : . : . : . : . :
JMFS066A10+ TTCTACCTGCACACATGGGTCTTGAGATGATGAGGAGCCGGTATCTTGTAGGTCTTGGCA
JMFS035C11+ TTCTACCTGCACACATGGGTCTTGAGATGATGAGGAGCCGGTATCTTGTAGGTCTTGGCA
                      ____________________________________________________________
consensus TTCTACCTGCACACATGGGTCTTGAGATGATGAGGAGCCGGTATCTTGTAGGTCTTGGCA
 
. : . : . : . : . : . :
JMFS066A10+ CTCAACTGGAGGAGAAGTGGAAGAGGGAGTTAATGCTGCTTGAGACATTGATGTGTCAGA
JMFS035C11+ CTCAACTGGAGGAGAAGTGGAAGAGGGAGTTAATGCTGCTTGAGACATTGATGTGTCAGA
                      ____________________________________________________________
consensus CTCAACTGGAGGAGAAGTGGAAGAGGGAGTTAATGCTGCTTGAGACATTGATGTGTCAGA
 
. : . : . : . : . : . :
JMFS066A10+ TGATGGAGGACAAGAAGACTGTTTTCCCTGTGCACAACCAGCTGCTTCAGCAGTACCATT
JMFS035C11+ TGATGGAGGACAAGAAGACTGTTTTCCCTGTGCACAACCAGCTGCTTCAGCAGTACCATT
                      ____________________________________________________________
consensus TGATGGAGGACAAGAAGACTGTTTTCCCTGTGCACAACCAGCTGCTTCAGCAGTACCATT
 
. : . : . : . : . : . :
JMFS066A10+ CACTGAAGCAGTAGAAGCCGTAGAAGTACGAGGAGATGCAGAC
JMFS035C11+ CACTGAAGCAGTAGAAGCCGTAGAAGTACGAGGAGATGCAGACCTTGATTTCCCACCTGA
                      ____________________________________________________________
consensus CACTGAAGCAGTAGAAGCCGTAGAAGTACGAGGAGATGCAGACCTTGATTTCCCACCTGA
 
. : . : . : . : . : . :
JMFS035C11+ CTGAGAATCCTTAGCAAGTGCAAATGCAGGTGGAGCACTGTTATACCTTGATGGTGGGTA
                      ____________________________________________________________
consensus CTGAGAATCCTTAGCAAGTGCAAATGCAGGTGGAGCACTGTTATACCTTGATGGTGGGTA