Previous Contig 003143:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030N01Sequence431003143 (5)gb:AY663785_16205887e-20Fragaria x ananassa UDP-glucose glucosyltransferase (sgt2) mRNA, complete cds.763010380 (5)sp|Q9MB73|LGT_CITUN5e-87Limonoid UDP-glucosyltransferase (EC 2.4.1.210) (Limonoid glucosyltransferase) (
JMFF044A05Sequence636003143 (5)sp|Q9MB73|LGT_CITUN1e-50Limonoid UDP-glucosyltransferase (EC 2.4.1.210) (Limonoid glucosyltransferase) (631010380 (5)gb:AY663785_16205881e-63Fragaria x ananassa UDP-glucose glucosyltransferase (sgt2) mRNA, complete cds.
JMFF050C17Sequence613003143 (5)sp|Q9MB73|LGT_CITUN3e-47Limonoid UDP-glucosyltransferase (EC 2.4.1.210) (Limonoid glucosyltransferase) (520010380 (5)gb:AY663785_16205883e-52Fragaria x ananassa UDP-glucose glucosyltransferase (sgt2) mRNA, complete cds.
JMFS034G08Sequence627003143 (5)gb:AY663785_16205882e-52Fragaria x ananassa UDP-glucose glucosyltransferase (sgt2) mRNA, complete cds.
JMSF044M04Sequence791003143 (5)sp|Q9MB73|LGT_CITUN2e-74Limonoid UDP-glucosyltransferase (EC 2.4.1.210) (Limonoid glucosyltransferase) (737010380 (5)gb:AY663785_16205881e-78Fragaria x ananassa UDP-glucose glucosyltransferase (sgt2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044M04+ ACCAACGGGCTTGATGGGGCAGAGCTTGGACATGTATTCAAGAACTTCCGGTTCCA
                      ____________________________________________________________
consensus ACCAACGGGCTTGATGGGGCAGAGCTTGGACATGTATTCAAGAACTTCCGGTTCCA
 
. : . : . : . : . : . :
JMSF044M04+ GTTCTTGAAACGTCTCCATTAAAACGTAAAACGGTTTGGACAAGTTCTCGAACTGGTTAA
                      ____________________________________________________________
consensus GTTCTTGAAACGTCTCCATTAAAACGTAAAACGGTTTGGACAAGTTCTCGAACTGGTTAA
 
. : . : . : . : . : . :
JMSF044M04+ GAATGGCCCGGGCCAGGAATTTATACGGCGAAGAAGGGTATAAGTAGCTCGGGAACTCGT
JMFF044A05+ TAGCTCGGGAACTCGT
JMFS034G08+ AAGGGTATAAGTAGCTCGGGAACTCGT
                      ____________________________________________________________
consensus GAATGGCCCGGGCCAGGAATTTATACGGCGAAGAAGGGTATAAGTAGCTCGGGAACTCGT
 
. : . : . : . : . : . :
JMSF044M04+ CGTATTTCAAAACCGGCATGCACGGCAACTGAACGTCGAGAAAAGGCTCTGTTTCAGTCG
JMFF050C17+ TTCAAAACCGGCATGCACGGCAACTGAACGTCGAGAAAAGGCTCTGTTTCAGTCG
JMFF044A05+ CGTATTTCAAAACCGGCATGCACGGCAACTGAACGTCGAGAAAAGGCTCTGTTTCAGTCG
JMFS034G08+ CGTATTTCAAAACCGGCATGCACGGCAACTGAACGTCGAGAAAAGGCTCTGTTTCAGTCG
                      ____________________________________________________________
consensus CGTATTTCAAAACCGGCATGCACGGCAACTGAACGTCGAGAAAAGGCTCTGTTTCAGTCG
 
. : . : . : . : . : . :
JMSF044M04+ GAAAAGGAACCAACTTATTCTGGTAATGATAATAAGCAGAAAAGCTCGCACAAGACTGCA
JMFF050C17+ GAAAAGGAACCAACTTATTATGGTAATGATAATAAGCAGAAAAGCTCGCACAAGACTGCA
JMFF044A05+ GAAAAGGAACCAACTTATTATGGTAATGATAATAAGCAGAAAAGCTCGCACAAGACTGCA
JMFS034G08+ GAAAAGGAACCAACTTATTATGGTAATGATAATAAGCAGAAAAGCTCGCACAAGACTGCA
                      ____________________________________________________________
consensus GAAAAGGAACCAACTTATTATGGTAATGATAATAAGCAGAAAAGCTCGCACAAGACTGCA
 
. : . : . : . : . : . :
JMSF044M04+ CCCAAAGCACCGCACTGGGAATCCCATGTTTCTCGGCGACATCGGAAACCCACGGTATGA
JMFF050C17+ CCCAAAGTACCGCACTGGGAATTCCATGTTTCTCGGCGACGTCGGAGACCCAGGGAATAA
JMFF044A05+ CCCAAAGTACCGCACTGGGAATTCCATGTTTCTCGGCGACGTCGGAGACCCAGGGAATAA
JMFS034G08+ CCCAAAGTACCGCACTGGGAATTCCATGTTTCTCGGCGACGTCGGAGACCCAGGGAATAA
                      ____________________________________________________________
consensus CCCAAAGTACCGCACTGGGAATTCCATGTTTCTCGGCGACGTCGGAGACCCAGGGAATAA
 
. : . : . : . : . : . :
JMSF044M04+ ACGGATTGTTGATCAGACAAGAAACAGGGCGCCCTTGTTTTTCGTGTTTGTCGAGGATCC
JMFF050C17+ ACGGATTGTTGATGAGACAAGAAACAGGGCGCCCCTGTTTTTCGTGTTTGTCGAGGATCC
JMFF030N01+ GTTGATGAGACAAGAAACAGGGCGCCCCTGTTTTTCGTGTTTGTCGAGGATCC
JMFF044A05+ ACGGATTGTTGATGAGACAAGAAACAGGGCGCCCCTGTTTTTCGTGTTTGTCGAGGATCC
JMFS034G08+ ACGGATTGTTGATGAGACAAGAAACAGGGCGCCCCTGTTTTTCGTGTTTGTCGAGGATCC
                      ____________________________________________________________
consensus ACGGATTGTTGATGAGACAAGAAACAGGGCGCCCCTGTTTTTCGTGTTTGTCGAGGATCC
 
. : . : . : . : . : . :
JMSF044M04+ CCGACAGCTTCACGGACCCGACTCGCTCCATTTGGTCCAGCTGGAAGTCGAGGTCGTTGG
JMFF050C17+ CCGACAGCTTCACGGCCCCGACTCGCTCCATTTGGTCGAGCTGGAAGTCCATGTCGTTGG
JMFF030N01+ CCGACAGCTTCACGGCCCCGACTCGCTCCATTTGGTCGAGCTGGAAGTCCATGTCGTTGG
JMFF044A05+ CCGACAGCTTCACGGCCCCGACTCGCTCCATTTGGTCGAGCTGGAAGTCCATGTCGTTGG
JMFS034G08+ CCGACAGCTTCACGGCCCCGACTCGCTCCATTTGGTCGAGCTGGAAGTCCATGTCGTTGG
                      ____________________________________________________________
consensus CCGACAGCTTCACGGCCCCGACTCGCTCCATTTGGTCGAGCTGGAAGTCCATGTCGTTGG
 
. : . : . : . : . : . :
JMSF044M04+ CGTGCGGGCCATGCGGGTCGAACTCGTCGTCGAAGAACTCGAACCTGATGAACCCGTCGC
JMFF050C17+ CGTGCGGGCCATGCGGGTCGAACTCGTCGTCGAAGAACTCGAACCTGATGAACCCGTCGC
JMFF030N01+ CGTGCGGGCCATGCGGGTCGAACTCGTCGTCGAAGAACTCGAACCTGATGAACCCGTCGC
JMFF044A05+ CGTGCGGGCCATGCGGGTCGAACTCGTCGTCGAAGAACTCGAACCTGATGAACCCGTCGC
JMFS034G08+ CGTGCGGGCCATGCGGGTCGAACTCGTCGTCGAAGAACTCGAACCTGATGAACCCGTCGC
                      ____________________________________________________________
consensus CGTGCGGGCCATGCGGGTCGAACTCGTCGTCGAAGAACTCGAACCTGATGAACCCGTCGC
 
. : . : . : . : . : . :
JMSF044M04+ CGTAGGGAGTGGGTTCTTCGCTGATTTTGGCGTTGGCTTTTCTCATCTCCACGCCCGTGC
JMFF050C17+ CGTAGGGAGTGGGTTCTTCGCTGATTTTCGCGTTGGCTTTTCTCATCTCCACGCCCGTGC
JMFF030N01+ CGTAGGGAGTGGGTTCTTCGCTGATTTTCGCGTTGGCTTTTCTCATCTCCACGCCCGTGC
JMFF044A05+ CGTAGGGAGTGGGTTCTTCGCTGATTTTCGCGTTGGCTTTTCTCATCTCCACGCCCGTGC
JMFS034G08+ CGTAGGGAGTGGGTTCTTCGCTGATTTTCGCGTTGGCTTTTCTCATCTCCACGCCCGTGC
                      ____________________________________________________________
consensus CGTAGGGAGTGGGTTCTTCGCTGATTTTCGCGTTGGCTTTTCTCATCTCCACGCCCGTGC
 
. : . : . : . : . : . :
JMSF044M04+ TTTCCGGTGCCGAGAAGGTGACCAGTAGGCCCTTGCCGGCGAGACGTTTGCCGAGGCGGA
JMFF050C17+ TTTCCGGTGCCGAGAAGGTGACGAGTAGGCCCTTTCCGGCGAGACGCTTGCCGAGGCGGA
JMFF030N01+ TTTCCGGTGCCGAGAAGGTGACGAGTAGGCCCTTTCCGGCGAGACGCTTGCCGAGGCGGA
JMFF044A05+ TTTCCGGTGCCGAGAAGGTGACGAGTAGGCCCTTTCCGGCGAGACGCTTGCCGAGGCGGA
JMFS034G08+ TTTCCGGTGCCGAGAAGGTGACGAGTAGGCCCTTTCCGGCGAGACGCTTGCCGAGGCGGA
                      ____________________________________________________________
consensus TTTCCGGTGCCGAGAAGGTGACGAGTAGGCCCTTTCCGGCGAGACGCTTGCCGAGGCGGA
 
. : . : . : . : . : . :
JMSF044M04+ GGAGAGGGTTCACGTGGCCTTGCCCGGGGAAGGAGACCATGAAAACATGGAGAGGTGGAA
JMFF050C17+ GGAGAGGGTTGACGTGGCCTTGCCCGGGGAAGGAGACCATGAAAACATGGAGAGGTGGAA
JMFF030N01+ GGAGAGGGTTGACGTGGCCTTGCCCGGGGAAGGAGACCATGAAAACATGGAGAGGTGGAA
JMFF044A05+ GGAGAGGGTTGACGTGGCCTTGCCCGGGGAAGGAGACCATGAAAACATGGAGAGGTGGAA
JMFS034G08+ GGAGAGGGTTGACGTGGCCTTGCCCGGGGAAGGAGACCATGAAAACATGGAGAGGTGGAA
                      ____________________________________________________________
consensus GGAGAGGGTTGACGTGGCCTTGCCCGGGGAAGGAGACCATGAAAACATGGAGAGGTGGAA
 
. : . : . : . : . : . :
JMSF044M04+ CGCCGCCGTTTTCAGAGCCCATGTCTCCGTCCTGAGCTTGATAAAATCTAT
JMFF050C17+ CGCCGCCGTTTTCAGAGCCCATTTCTCCGTCCTGAGCTTGATAAAATCTAT
JMFF030N01+ CGCCGCCGTTTTCAGAGCCCATTTCTCCGTCCTGAGCTTGATAAAATCTAT
JMFF044A05+ CGCCGCCGTTTTCAGAGCCCATTTCTCCGTCCTGAGCTTGATAAAATCTAT
JMFS034G08+ CGCCGCCGTTTTCAGAGCCCATTTCTCCGTCCTGAGCTTGATAAAATCTATCTATATTTC
                      ____________________________________________________________
consensus CGCCGCCGTTTTCAGAGCCCATTTCTCCGTCCTGAGCTTGATAAAATCTATCTATATTTC