Previous Contig 003138:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS034E04Sequence624003138 (2)pir|D86278|D862786e-36hypothetical protein F14L17.16 - Arabidopsis thaliana>gb:AE005172_890432 Arabido
JMSF046P21Sequence674003138 (2)pir|D86278|D862784e-45hypothetical protein F14L17.16 - Arabidopsis thaliana>gb:AE005172_890432 Arabido667024234pir|D86278|D862788e-42hypothetical protein F14L17.16 - Arabidopsis thaliana>gb:AE005172_890432 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046P21+ TGTGGAACCTGGGATCTCAGGGAATTGTTGGCTAGGACAAGTTTAACAATGTTGTT
                      ____________________________________________________________
consensus TGTGGAACCTGGGATCTCAGGGAATTGTTGGCTAGGACAAGTTTAACAATGTTGTT
 
. : . : . : . : . : . :
JMSF046P21+ TCCCAAGGAGGGGAAACTTGGTCCTAAGTTGTTGCCACTCAAATCAACCTCTTCGAGCCC
JMFS034E04+ CACTCAAATC-ACCTCTTCGAGCNC
                      ____________________________________________________________
consensus TCCCAAGGAGGGGAAACTTGGTCCTAAGTTGTTGCCACTCAAATCAACCTCTTCGAGCCC
 
. : . : . : . : . : . :
JMSF046P21+ CGATACCCCCTTCAGATCCGGGATACTCCCATTCAACAAGTTATGACTCAAAACCAGGCT
JMFS034E04+ CGATACCCCCTTCAGATCCGGGATACTCCCATTCAACAAGTTATGACTCAAAACCAGGCT
                      ____________________________________________________________
consensus CGATACCCCCTTCAGATCCGGGATACTCCCATTCAACAAGTTATGACTCAAAACCAGGCT
 
. : . : . : . : . : . :
JMSF046P21+ TTTCAGGTTCTTGAACTTGGCTATGGATTGGGGAATGCCGCCACGGATTTGGTTCGAGCT
JMFS034E04+ TTTCAGGTTCTTGAACTTGGCTATGGATTGGGGAATGCCGCCACGGATTTGGTTCGAGCT
                      ____________________________________________________________
consensus TTTCAGGTTCTTGAACTTGGCTATGGATTGGGGAATGCCGCCACGGATTTGGTTCGAGCT
 
. : . : . : . : . : . :
JMSF046P21+ GAGGTTTAACGCCTCGAGCCCGCCAAACCTGGTGATCTTAGCCGGCAAAGAACCCCATAA
JMFS034E04+ GAGGTTTAACGCCTCGAGCCCGCCAAACCTGGTGATCTTAGCCGGCAAAGAACCCCATAA
                      ____________________________________________________________
consensus GAGGTTTAACGCCTCGAGCCCGCCAAACCTGGTGATCTTAGCCGGCAAAGAACCCCATAA
 
. : . : . : . : . : . :
JMSF046P21+ CCCGAGATTCACCAATGACAATCTCTTCAAGCTGGAAAGCTTGGTGAGAAGAGTGAAGAA
JMFS034E04+ CCCGAGATTCACCAATGACAATCTCTTCAAGCTGGAAAGCTTGGTGAGAAGAGTGAAGAA
                      ____________________________________________________________
consensus CCCGAGATTCACCAATGACAATCTCTTCAAGCTGGAAAGCTTGGTGAGAAGAGTGAAGAA
 
. : . : . : . : . : . :
JMSF046P21+ TGAATCAAGAGAGAAATTCTGGGAAAGATGGGAGGCTTTGTTTCCAAGAATTGTAAGTTC
JMFS034E04+ TGAATCAAGAGAGAAATTCTGGGAAAGATGGGAGGCTTTGTTTCCAAGAATTGTAAGTTC
                      ____________________________________________________________
consensus TGAATCAAGAGAGAAATTCTGGGAAAGATGGGAGGCTTTGTTTCCAAGAATTGTAAGTTC
 
. : . : . : . : . : . :
JMSF046P21+ TGTGATGTGATTCCCAGAACAGGTGATCACTAGAGAAGGGGTTTGTGGGAGAAAGCAGAA
JMFS034E04+ TGTGATGTGATTCCCAGAACAGGTGATCACTAGAGAAGGGGTTTGTGGGAGAAAGCAGAA
                      ____________________________________________________________
consensus TGTGATGTGATTCCCAGAACAGGTGATCACTAGAGAAGGGGTTTGTGGGAGAAAGCAGAA
 
. : . : . : . : . : . :
JMSF046P21+ ATTTGTCCAGTTATTCCAGCCTTGAAGAGCTTGGGGGTATTCAAGAAGCTGCTGAACCTG
JMFS034E04+ ATTTGTCCAGTTATTCCAGCCTTGAAGAGCTTGGGGGTATTCAAGAAGCTGCTGAACCTG
                      ____________________________________________________________
consensus ATTTGTCCAGTTATTCCAGCCTTGAAGAGCTTGGGGGTATTCAAGAAGCTGCTGAACCTG
 
. : . : . : . : . : . :
JMSF046P21+ GAATAGGATCCTCTTCTCTGAGGATAACAATTGTGCAGAAGAAACTGGGATTAGCAGAAG
JMFS034E04+ GAATAGGATCCTCTTCTCTGAGGATAACAATTGTGCAGAAGAAACTGGGATTAGCAGAAG
                      ____________________________________________________________
consensus GAATAGGATCCTCTTCTCTGAGGATAACAATTGTGCAGAAGAAACTGGGATTAGCAGAAG
 
. : . : . : . : . : . :
JMSF046P21+ CAGGAACAGGGAACAAACCAAGAAACTGGGCTTCATCTTTTTTCTTGTTTTTGTGAGGAA
JMFS034E04+ CAGGAACAGGGAACAAACCAAGAAACTGGGCTTCATCTTTTTTCTTGTTTTTGTGAGGAA
                      ____________________________________________________________
consensus CAGGAACAGGGAACAAACCAAGAAACTGGGCTTCATCTTTTTTCTTGTTTTTGTGAGGAA
 
. : . : . : . : . : . :
JMSF046P21+ TTGAATCTCAAGTTCCC
JMFS034E04+ TTGAATCTCAAGTTCCCATCAATCTACTAGGCTAGAAAGAAAAATATGGAGCTTTTTCAC
                      ____________________________________________________________
consensus TTGAATCTCAAGTTCCCATCAATCTACTAGGCTAGAAAGAAAAATATGGAGCTTTTTCAC