Previous Contig 003136:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN016D19Sequence605003136 (4)gb:CAN297410_16450734e-88Capsicum annuum mRNA for osmotin-like protein (pr5 p23 gene).>gb:AF297646_178407
JMFN025P06Sequence608003136 (4)gb:CAN297410_16450732e-83Capsicum annuum mRNA for osmotin-like protein (pr5 p23 gene).>gb:AF297646_178407
JMFS034A09Sequence624003136 (4)gb:CAN297410_16450733e-73Capsicum annuum mRNA for osmotin-like protein (pr5 p23 gene).>gb:AF297646_178407
JMFS109D06Sequence625003136 (4)gb:CAN297410_16450732e-91Capsicum annuum mRNA for osmotin-like protein (pr5 p23 gene).>gb:AF297646_178407

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN016D19+ GCATCAGGGC
JMFN025P06+ GCATCAGGGC
JMFS109D06+ TGAGGGTAACTATAAGCATCAGGGC
JMFS034A09+ TGAGGGTAACTATAAGCATCAGGGC
                      ____________________________________________________________
consensus TGAGGGTAACTATAAGCATCAGGGC
 
. : . : . : . : . : . :
JMFN016D19+ ATAAGCCCTTGAAGAATTTTGAATAATCACTAGGTCCACATGGTCCCTCGGTGCAGCAAT
JMFN025P06+ ATAAGCCCTGNAAGAA-TTTGAATAATCACTAGGTCCACATGGTCCCTCGGTGCAGCAAT
JMFS109D06+ ATAAGCCCTTGAAGAATTTTGAATAATCACTAGGTCCACATGGTCCCTCGGTGCAGCAAT
JMFS034A09+ ATAAGCCCTTGAAGAATTTTGAATAATCACTAGGTCCACATGGTCCCTCGGTGCAGCAAT
                      ____________________________________________________________
consensus ATAAGCCCTTGAAGAATTTTGAATAATCACTAGGTCCACATGGTCCCTCGGTGCAGCAAT
 
. : . : . : . : . : . :
JMFN016D19+ ATTGTTGTCCTCCGAAGGTGGTGCAAGGGTTGTTACAGCCGCCGGGGACTTTCAGAGCGG
JMFN025P06+ ATTGTTGTCCTCCGAAGGTGGTGCAAGGGTTGTTACAGCCGCCGGGGACTTTCAGAGCGG
JMFS109D06+ ATTGTTGTCCTCCGAAGGTGGTGCAAGGGTTGTTACAGCCGCCGGGGACTTTCAGAGCGG
JMFS034A09+ ATTGTTGTCCTCCGAAGGTGGTGCAAGGGTTGTTACAGCCGCCGGGGACTTTCAGAGCGG
                      ____________________________________________________________
consensus ATTGTTGTCCTCCGAAGGTGGTGCAAGGGTTGTTACAGCCGCCGGGGACTTTCAGAGCGG
 
. : . : . : . : . : . :
JMFN016D19+ CGGGGCATTGGCCGTTGACATCAGCCGTGCATGAGATTGCATGGCACTTGTCGGCGCCGG
JMFN025P06+ CGGGGCATTGGCCGTTGACATCAGCCGTGCATGAGATTGCATGGCACTTGTCGGCGCCGG
JMFS109D06+ CGGGGCATTGGCCGTTGACATCAGCCGTGCATGAGATTGCATGGCACTTGTCGGCGCCGG
JMFS034A09+ CGGGGCATTGGCCGTTGACATCAGCCGTGCATGAGATTGCATGGCACTTGTCGGCGCCGG
                      ____________________________________________________________
consensus CGGGGCATTGGCCGTTGACATCAGCCGTGCATGAGATTGCATGGCACTTGTCGGCGCCGG
 
. : . : . : . : . : . :
JMFN016D19+ GCTTGGTGGGGGCAAAGTTCAGGGGGACGTTGAATCCGTCGACGAGTGAGATGTCGATGG
JMFN025P06+ GCTTGGTGGGGGCAAAGTTCAGGGGGACGTTGAATCCGTCGACGAGTGAGATGTCGATGG
JMFS109D06+ GCTTGGTGGGGGCAAAGTTCAGGGGGACGTTGAATCCGTCGACGAGTGAGATGTCGATGG
JMFS034A09+ GCTTGGTGGGGGCAAAGTTCAGGGGGACGTTGAATCCGTCGACGAGTGAGATGTCGATGG
                      ____________________________________________________________
consensus GCTTGGTGGGGGCAAAGTTCAGGGGGACGTTGAATCCGTCGACGAGTGAGATGTCGATGG
 
. : . : . : . : . : . :
JMFN016D19+ TGTCGAAGTTGTTGTCTCCCGTTAGTGTGAATTCGGCGAGGGTGTTGGGCGGTTTTCCCC
JMFN025P06+ TGTCGAAGTTGTTGTCTCCCGTTAGTGTGAATTCGGCGAGGGTGTTGGGCGGTTTTCCCC
JMFS109D06+ TGTCGAAGTTGTTGTCTCCCGTTAGTGTGAATTCGGCGAGGGTGTTGGGCGGTTTTCCCC
JMFS034A09+ TGTCGAAGTTGTTGTCTCCCGTTAGTGTGAATTCGGCGAGGGTGTTGGGCGGTTTTCCCC
                      ____________________________________________________________
consensus TGTCGAAGTTGTTGTCTCCCGTTAGTGTGAATTCGGCGAGGGTGTTGGGCGGTTTTCCCC
 
. : . : . : . : . : . :
JMFN016D19+ AGGCGGTGCACTGCAACACGCCGCCGCAGTCGCCGGTCTCGCAGGAGCCCCTCCCACTGG
JMFN025P06+ AGGCGGTGCACTGCAACACGCCGCCGCAGTCGCCGGTCTCGCAGGAGCCCCTCCCACTGG
JMFS109D06+ AGGCGGTGCACTGCAACACGCCGCCGCAGTCGCCGGTCTCGCAGGAGCCCCTCCCACTGG
JMFS034A09+ AGGCGGTGCACTGCAACACGCCGCCGCAGTCGCCGGTCTCGCAGGAGCCCCTCCCACTGG
                      ____________________________________________________________
consensus AGGCGGTGCACTGCAACACGCCGCCGCAGTCGCCGGTCTCGCAGGAGCCCCTCCCACTGG
 
. : . : . : . : . : . :
JMFN016D19+ CGTCAAAGTTGCAATTTGTGCGGCCCCATATACGTGCCATTCTCGTGCCACCGGGCACGT
JMFN025P06+ CGTCAAAGTTGCAATTTGTGCGGCCCCATATACGTGCCATTCTCGTGCCACCGGGCACGT
JMFS109D06+ CGTCAAAGTTGCAATTTGTGCGGCCCCATATACGTGCCATTCTCGTGCCACCGGGCACGT
JMFS034A09+ CGTCAAAGTTGCAATTTGTGCGGCCCCATATACGTGCCATTCTCGTGCCACCGGGCACGT
                      ____________________________________________________________
consensus CGTCAAAGTTGCAATTTGTGCGGCCCCATATACGTGCCATTCTCGTGCCACCGGGCACGT
 
. : . : . : . : . : . :
JMFN016D19+ CAATTGTCCAACTTTGGCCTTGATCGAGCTGCTTGCCGCCGCCAACTGGCGTCGCTGCCG
JMFN025P06+ CAATTGTCCAACTTTGGCCTTGATCGAGCTGCTTGCCGCCGCCAACTGGCGTCGCTGCCG
JMFS109D06+ CAATTGTCCAACTTTGGCCTTGATCGAGCTGCTTGCCGCCGCCAACTGGCGTCGCTGCCG
JMFS034A09+ CAATTGTCCAAC-CCGCCCTTGATCGAGCTGCTTGCCGCCGCCAACTGGCGTCGCTGCCG
                      ____________________________________________________________
consensus CAATTGTCCAACTTTGGCCTTGATCGAGCTGCTTGCCGCCGCCAACTGGCGTCGCTGCCG
 
. : . : . : . : . : . :
JMFN016D19+ CCCAGACGGTGTATTGGCAGTTGTTGCGGATTTCAAAGGTGGCGGCGTAGCCGGACGTGA
JMFN025P06+ CCCAGACGGTGTATTGGCAGTTGTTGCGGATTTCAAAGGTGGCGGCGTAGCCGGACGTGA
JMFS109D06+ CCCAGACGGTGTATTGGCAGTTGTTGCGGATTTCAAAGGTGGCGGCGTAGCCGGACGTGA
JMFS034A09+ CCCAGACGGTGTATTGGCAGTTGTTGCGGATTTCAAAGGTGGCGGCGTAGCCGGACGTGA
                      ____________________________________________________________
consensus CCCAGACGGTGTATTGGCAGTTGTTGCGGATTTCAAAGGTGGCGGCGTAGCCGGACGTGA
 
. : . : . : . : . : . :
JMFN016D19+ AGAGGCTGAGGAGGAGGAGCAACGGGAGGGTGGCTAAGTAATCCATATTGGTAAA
JMFN025P06+ AGAGGCTGAGGAGGAGGAGCAACGGGAGGGTGGCTAAGTAATCCATATTGGTAAA
JMFS109D06+ AGAGGCTGAGGAGGAGGAGCAACGGGAGGGTGGCTAAGTAATCCATATTGGTAAA
JMFS034A09+ AGAGGCTGAGGAGGAGGAGCAACGGGAGGGTGGCTAAGTAATCCATATTGGTAAACTCAA
                      ____________________________________________________________
consensus AGAGGCTGAGGAGGAGGAGCAACGGGAGGGTGGCTAAGTAATCCATATTGGTAAACTCAA