Previous Contig 003126:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS032G06Sequence620003126 (3)
JMFS061E07Sequence592003126 (3)
JMFS073A11Sequence624003126 (3)gb:AY046028_15615203e-04Arabidopsis thaliana putative trehalose-6-phosphate synthase (At1g68020) mRNA, c

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS073A11+ GGCTACAGTGGCAACCCGGGAGAGTTTCTT
                      ____________________________________________________________
consensus GGCTACAGTGGCAACCCGGGAGAGTTTCTT
 
. : . : . : . : . : . :
JMFS073A11+ CNCCGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGA
                      ____________________________________________________________
consensus CNCCGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGA
 
. : . : . : . : . : . :
JMFS073A11+ CCTCGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAG
                      ____________________________________________________________
consensus CCTCGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAG
 
. : . : . : . : . : . :
JMFS073A11+ CAAGTGATAGAAATCAAACTCTGGGGAAAAATGGGAAACATCAACTGTTAAAAGAGAGCA
                      ____________________________________________________________
consensus CAAGTGATAGAAATCAAACTCTGGGGAAAAATGGGAAACATCAACTGTTAAAAGAGAGCA
 
. : . : . : . : . : . :
JMFS073A11+ GAATATAATAACACAAACTACTAAGAGTGAATACAAAAGTAGGAATTATTGGTCCCATTC
                      ____________________________________________________________
consensus GAATATAATAACACAAACTACTAAGAGTGAATACAAAAGTAGGAATTATTGGTCCCATTC
 
. : . : . : . : . : . :
JMFS073A11+ AAGAAACACAATCATAACACAAACTACTAAGTGTGAATCCAGGACCCCTCACATAATTAT
                      ____________________________________________________________
consensus AAGAAACACAATCATAACACAAACTACTAAGTGTGAATCCAGGACCCCTCACATAATTAT
 
. : . : . : . : . : . :
JMFS073A11+ TGCTTCTCACAATAATATAACAGAAATGATATGAATTCAAATTAACCACAGAATCTCCAT
JMFS032G06+ ATTAACCACAGAATCTCCAT
                      ____________________________________________________________
consensus TGCTTCTCACAATAATATAACAGAAATGATATGAATTCAAATTAACCACAGAATCTCCAT
 
. : . : . : . : . : . :
JMFS073A11+ GAAAACACAAATAATCATCAAGAACTAACAGAAATGATATGAATTCAAATTAACCACAGA
JMFS061E07+ AAATAATCATCAAGAACTAACAGAAATGATATGAATTCAAATTAACCACAGA
JMFS032G06+ GAAAACACAAATAATCATCAAGAACTAACAGAAATGATATGAATTCAAATTAACCACAGA
                      ____________________________________________________________
consensus GAAAACACAAATAATCATCAAGAACTAACAGAAATGATATGAATTCAAATTAACCACAGA
 
. : . : . : . : . : . :
JMFS073A11+ ATCTCCATGAAAACACAAATAATCATCAAAGCAATCCAGAAATTACAGAAGCCAGAAGAC
JMFS061E07+ ATCTCCATGAAAACACAAATAATCATCAAAGCAATCCAGAAATTACAGAAGCCAGAAGAC
JMFS032G06+ ATCTCCATGAAAACACAAATAATCATCAAAGCAATCCAGAAATTACAGAAGCCAGAAGAC
                      ____________________________________________________________
consensus ATCTCCATGAAAACACAAATAATCATCAAAGCAATCCAGAAATTACAGAAGCCAGAAGAC
 
. : . : . : . : . : . :
JMFS073A11+ AAAATCCCTCTAAATATGTGATCAAACTTGAATTTAAAAGGAAAAGGATTTGAAGGAACC
JMFS061E07+ AAAATCTCTCTAAATATGTGATCAAACTTGAATTTAAAAGGAAAAGGATTTGAAGGAACC
JMFS032G06+ AAAATCCCTCTAAATATGTGATCAAACTTGAATTTAAAAGGAAAAGGATTTGAAGGAACC
                      ____________________________________________________________
consensus AAAATCCCTCTAAATATGTGATCAAACTTGAATTTAAAAGGAAAAGGATTTGAAGGAACC
 
. : . : . : . : . : . :
JMFS073A11+ TGCAAAGAGGGATAAACACAACCTAACCCAAAGCTAAATCTAATCAGAGATTCA
JMFS061E07+ TGCAAAGAGGGATAAACACAACCTAACCCAAAGCTAAATCTAATCAGAGATTCAGAGAAA
JMFS032G06+ TGCAAAGAGGGATAAACACAACCTAACCCAAAGCTAAATCTAATCAGAGATTCAGAGAAA
                      ____________________________________________________________
consensus TGCAAAGAGGGATAAACACAACCTAACCCAAAGCTAAATCTAATCAGAGATTCAGAGAAA
 
. : . : . : . : . : . :
JMFS061E07+ ACAAGTGAGCATAAGAAAAATCACCTGAATAAATGACAAAATCAAGAAAACCCAAGCAGT
JMFS032G06+ ACAAGTGAGCATAAGAAAAATCACCTGAATAAATGACAAAATCAAGAAAACCCAAGCAGT
                      ____________________________________________________________
consensus ACAAGTGAGCATAAGAAAAATCACCTGAATAAATGACAAAATCAAGAAAACCCAAGCAGT
 
. : . : . : . : . : . :
JMFS061E07+ AGATAATCCATCATTAAAGATGAGAAAAAGCAATAACCACTGAAATCGAAAGCTACCCAA
JMFS032G06+ AGATAATCCATCATTAAAGATGAGAAAAAGCAATAACCACTGAAATCGAAAGCTACCCAA
                      ____________________________________________________________
consensus AGATAATCCATCATTAAAGATGAGAAAAAGCAATAACCACTGAAATCGAAAGCTACCCAA
 
. : . : . : . : . : . :
JMFS061E07+ TCTTCCATCAAGAGCAGTAATGTCCAAGAGAGTGCGAGAGAATCCACTAGGCTAGTTACT
JMFS032G06+ TCTTCCATCAAGAGCAGTAATGTCCAAGAGAGTGCGAGAGAATCCACTAGGCTAGTTACT
                      ____________________________________________________________
consensus TCTTCCATCAAGAGCAGTAATGTCCAAGAGAGTGCGAGAGAATCCACTAGGCTAGTTACT
 
. : . : . : . : . : . :
JMFS061E07+ AGTAAAAGCAACACTACAACTAATTCAAACAAATATTCTGAGGTTTCAACAAAGTGAATA
JMFS032G06+ AGTAAAAGCAACACTACAACTAATTCAAACAAATATTCTGAGGTTTCAACAAAGTGAATA
                      ____________________________________________________________
consensus AGTAAAAGCAACACTACAACTAATTCAAACAAATATTCTGAGGTTTCAACAAAGTGAATA
 
. : . : . : . : . : . :
JMFS061E07+ AATTACTATACTGTTTGCCAGTGCTCGCACGTAGCAAAAACAAAGAACCCAAAATAATAT
JMFS032G06+ AATTACTATACTGTTTGCCAGTGCTCGCACGTAGCAAAAACAAAGAACCCAAAATAATAT
                      ____________________________________________________________
consensus AATTACTATACTGTTTGCCAGTGCTCGCACGTAGCAAAAACAAAGAACCCAAAATAATAT
 
. : . : . : . : . : . :
JMFS061E07+ AAATAAATAAAAATGACCAATCAGTAAGCAAACTACAGTAAATAAGAACCTTT
JMFS032G06+ AAATAAATAAAAATGACCAATCAGTAAGCAAACTACAGTAAATAAGAACCTTTGATAGTT
                      ____________________________________________________________
consensus AAATAAATAAAAATGACCAATCAGTAAGCAAACTACAGTAAATAAGAACCTTTGATAGTT