Previous Contig 003125:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS017F07Sequence646003125 (2)pir|T52301|T523012e-59GYMNOS/PICKLE protein [imported] - Arabidopsis thaliana>gb:AF185577_1775125 Arab
JMFS032F07Sequence535003125 (2)pir|T52301|T523011e-21GYMNOS/PICKLE protein [imported] - Arabidopsis thaliana>gb:AF185577_1775125 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS017F07+ GTCAGTCATCGATGACAT
                      ____________________________________________________________
consensus GTCAGTCATCGATGACAT
 
. : . : . : . : . : . :
JMFS017F07+ TTGACGATGGAAGTTGTTCACTTTTGTCTTTAGACGAGGAAGAGTCTGGTAAGCTTTGAC
                      ____________________________________________________________
consensus TTGACGATGGAAGTTGTTCACTTTTGTCTTTAGACGAGGAAGAGTCTGGTAAGCTTTGAC
 
. : . : . : . : . : . :
JMFS017F07+ AAACTCATTCTCCGGCACCCAAGAACTATGAAGATAAGAGAATCCTTTCCACTTAACAAG
                      ____________________________________________________________
consensus AAACTCATTCTCCGGCACCCAAGAACTATGAAGATAAGAGAATCCTTTCCACTTAACAAG
 
. : . : . : . : . : . :
JMFS017F07+ ATACTGTTTCACAAATATTTGCTTTGATCCCAGTTTTGAAGCATCACTATCATCAGCAAT
                      ____________________________________________________________
consensus ATACTGTTTCACAAATATTTGCTTTGATCCCAGTTTTGAAGCATCACTATCATCAGCAAT
 
. : . : . : . : . : . :
JMFS017F07+ AGTTGGGCGTGTTTCACAATCCAATATTTTCTCAATATCATTGAGAGGGCTCACACATTC
                      ____________________________________________________________
consensus AGTTGGGCGTGTTTCACAATCCAATATTTTCTCAATATCATTGAGAGGGCTCACACATTC
 
. : . : . : . : . : . :
JMFS017F07+ AGGGCACTTCCAGCTGCTAGGAAAAGGGGCTCTCATAGGTTGAAGCAAACACTTTGGATG
JMFS032F07+ ACTTCCAGCTGCTAGGAAAAGGGGCTCTCATAGGTTGAAGCAAACACTTTGGATG
                      ____________________________________________________________
consensus AGGGCACTTCCAGCTGCTAGGAAAAGGGGCTCTCATAGGTTGAAGCAAACACTTTGGATG
 
. : . : . : . : . : . :
JMFS017F07+ ATATGCATAAGTACATGTTTCACAGTTCAAGAGATTCTCATCTCCACCACAAGCTTGACA
JMFS032F07+ ATATGCATAAGTACATGTTTCACAGTTCAAGAGATTCTCATCTCCACCACAAGCTTGACA
                      ____________________________________________________________
consensus ATATGCATAAGTACATGTTTCACAGTTCAAGAGATTCTCATCTCCACCACAAGCTTGACA
 
. : . : . : . : . : . :
JMFS017F07+ AGAATCAACTTTCGCATCCGGTCTGTCAAATCTCTCAACTGGCTCCTGTGAAGGGCCAGA
JMFS032F07+ AGAATCAACTTTCGCATCCGGTCTGTCAAATCTCTCAACTGGCTCCTGTGAAGGGCCAGA
                      ____________________________________________________________
consensus AGAATCAACTTTCGCATCCGGTCTGTCAAATCTCTCAACTGGCTCCTGTGAAGGGCCAGA
 
. : . : . : . : . : . :
JMFS017F07+ TTTGCCACGCCTAATATCAGCTTCATCGTCGGAATCGTCTAAATTGTAAACAGGCCTTCG
JMFS032F07+ TTTGCCACGCCTAATATCAGCTTCATCGTCGGAATCGTCTAAATTGTAAACAGGCCTTCG
                      ____________________________________________________________
consensus TTTGCCACGCCTAATATCAGCTTCATCGTCGGAATCGTCTAAATTGTAAACAGGCCTTCG
 
. : . : . : . : . : . :
JMFS017F07+ ATCCGACCGAACGCGAAGCCTTTCCACCAAACTAGCCATTTCC
JMFS032F07+ ATCCGACCGAACGCGAAGCCTTTCCACCAAACTAGCCATTTCCTTCAGTAGAACATTATT
                      ____________________________________________________________
consensus ATCCGACCGAACGCGAAGCCTTTCCACCAAACTAGCCATTTCCTTCAGTAGAACATTATT
 
. : . : . : . : . : . :
JMFS032F07+ AGGTTAGGACGTAATTGAGCTAAAATTGATGTGTGAAACGTGAATGTCAGTTAGGGCTTT
                      ____________________________________________________________
consensus AGGTTAGGACGTAATTGAGCTAAAATTGATGTGTGAAACGTGAATGTCAGTTAGGGCTTT
 
. : . : . : . : . : . :
JMFS032F07+ TGGGCAACTGATTCCCGGAATCTTTAACGGAATCGTATATTATGCAAAGAGGTCCGACAG
                      ____________________________________________________________
consensus TGGGCAACTGATTCCCGGAATCTTTAACGGAATCGTATATTATGCAAAGAGGTCCGACAG
 
. : . : . : . : . : . :
JMFS032F07+ ACCTGAAAAGTCACTCTATATACGCGGCGGAGAAAGACAGAGCTGGGAACTCGGCCGCTC
                      ____________________________________________________________
consensus ACCTGAAAAGTCACTCTATATACGCGGCGGAGAAAGACAGAGCTGGGAACTCGGCCGCTC
 
. : . : . : . : . : . :
JMFS032F07+ TCTCCGTTGAGGGTTTGATTCTGAAATTCAGAAGATATTCATAGCTGCAAGTAAAGTGGC
                      ____________________________________________________________
consensus TCTCCGTTGAGGGTTTGATTCTGAAATTCAGAAGATATTCATAGCTGCAAGTAAAGTGGC