Previous Contig 003116:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050G06Sequence548003116 (4)618010989 (2)gb:AP003376_18287433e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMFS031F12Sequence523003116 (4)
JMFS058D11Sequence642003116 (4)gb:AY080703_15684259e-53Arabidopsis thaliana putative casein kinase (At3g13670) mRNA, complete cds.>gb:A
JMSF051J07Sequence635003116 (4)790010989 (2)gb:AP003376_18287436e-91Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS058D11+ AAGCTAGGACCCAGCATGTCCATAA
                      ____________________________________________________________
consensus AAGCTAGGACCCAGCATGTCCATAA
 
. : . : . : . : . : . :
JMFS058D11+ CCATTATGTAGTAGTCACCCTGTTTGCCTTTATAATGTACTCTCGGCACACCATGACTGC
                      ____________________________________________________________
consensus CCATTATGTAGTAGTCACCCTGTTTGCCTTTATAATGTACTCTCGGCACACCATGACTGC
 
. : . : . : . : . : . :
JMFS058D11+ CACCAAGCGTGTTGTAAACTTGCCACTCATATGGAGGCCCATAGCTACATCCTTTGCTAT
                      ____________________________________________________________
consensus CACCAAGCGTGTTGTAAACTTGCCACTCATATGGAGGCCCATAGCTACATCCTTTGCTAT
 
. : . : . : . : . : . :
JMFS058D11+ TTCGGTGCTCAAACTTCAGGGCAACCTCCGCAGCCCCCGCACCACTACGTTCATTACCAC
                      ____________________________________________________________
consensus TTCGGTGCTCAAACTTCAGGGCAACCTCCGCAGCCCCCGCACCACTACGTTCATTACCAC
 
. : . : . : . : . : . :
JMFS058D11+ CAGAAACACGGCGGCCCAAAAAGACTTGACCAAAACCACCTTTGCCCAGCTTCTTTTCAA
                      ____________________________________________________________
consensus CAGAAACACGGCGGCCCAAAAAGACTTGACCAAAACCACCTTTGCCCAGCTTCTTTTCAA
 
. : . : . : . : . : . :
JMFS058D11+ CTTTATAGACCGGTGACTGTCCTATTTGCACCTCATCAGGGAAGGGAGGAGTGTTTCCCT
                      ____________________________________________________________
consensus CTTTATAGACCGGTGACTGTCCTATTTGCACCTCATCAGGGAAGGGAGGAGTGTTTCCCT
 
. : . : . : . : . : . :
JMFS058D11+ CGTCCTCGCCAGTCCCTTTGTTATTGGCACTCAATCCACCGCTCTCATCCCCCATCTCTT
JMSF051J07+ TCGCCAGTCCCTTTGTTATTGGCACTCAATCCACCGCTCTCATCCCCCATCTCTT
                      ____________________________________________________________
consensus CGTCCTCGCCAGTCCCTTTGTTATTGGCACTCAATCCACCGCTCTCATCCCCCATCTCTT
 
. : . : . : . : . : . :
JMFS058D11+ CCTCTGCCCCTTCTTCTTCCCTCTCTTTAGCCTTTATCTCCTCTTCTTCCCTCTTTGCCT
JMSF051J07+ CCTCTGCCCCTTCTTCTTCCCTCTCTTTAGCCTTTATCTCCTCTTCTTCCCTCTTTGCCT
                      ____________________________________________________________
consensus CCTCTGCCCCTTCTTCTTCCCTCTCTTTAGCCTTTATCTCCTCTTCTTCCCTCTTTGCCT
 
. : . : . : . : . : . :
JMFS058D11+ TCTCGGCCTCAACCTTTGCTTTAGCGGCCTCTTCCTCCTCGACTTTGGCTTTGGCTTTAG
JMSF051J07+ TCTCGGCCTCAACCTTTGCTTTAGCGGCCTCTTCCTCCTCGACTTTGGCTTTGGCTTTAG
JMFF050G06+ TTGCTTTAGCGGCCTCTTCCTCCTCGACTTTGGCTTTGGCTTTAG
                      ____________________________________________________________
consensus TCTCGGCCTCAACCTTTGCTTTAGCGGCCTCTTCCTCCTCGACTTTGGCTTTGGCTTTAG
 
. : . : . : . : . : . :
JMFS058D11+ CCTTGGCTGCTCGCGTCTTAATATAAGTACTCCTAACAACTAAATCTTCTTCTTTCCCTT
JMSF051J07+ CCTTGGCTGCTCGCGTCTTAATATAAGTACTCCTAACAACTAAATCTTCTTCTTTCCCTT
JMFF050G06+ CCTTGGCTGCTCGCGTCTTAATATAAGTACTCCTAACAACTAAATCTTCTTCTTTCCCTT
JMFS031F12+ AATATAAGTACTCCTAACAACTAAATCTTGTTCTTTCCCTT
                      ____________________________________________________________
consensus CCTTGGCTGCTCGCGTCTTAATATAAGTACTCCTAACAACTAAATCTTCTTCTTTCCCTT
 
. : . : . : . : . : . :
JMFS058D11+ GACTCTTCGGTGTCTGTGGATTCTGCAACTGTTTTCGTCCTGGATCCGGCTTCGGTCCTT
JMSF051J07+ GACTCTTCGGTGTCTGTGGATTCTGCAACTGTTTTCGTCCTGGATCCGGCTTCGGTCCTT
JMFF050G06+ GACTCTTCGGTGTCTGTGGATTCTGCAACTGTTTTCGTCCTGGATCCGGCTTCGGTCCTT
JMFS031F12+ GAGTGTTCGGTGTCTGTGGATTCTGCAACTGTTTTGGTCCTGGATCGGGCTTCGGTCCTT
                      ____________________________________________________________
consensus GACTCTTCGGTGTCTGTGGATTCTGCAACTGTTTTCGTCCTGGATCCGGCTTCGGTCCTT
 
. : . : . : . : . : . :
JMFS058D11+ TAGCCCTTACCAGAGAA
JMSF051J07+ TAGCCCTTACCAGAGAAGCGCGGCGGCGGCCTCCACTCTGCAACTCCGGCATCCTCCTCT
JMFF050G06+ TAGCCCTTACCAGAGAAGCGCGGCGGCGGCCTCCACTCTGCAACTCCGGCATCCTCCTCT
JMFS031F12+ TAGCCCTTACCAGAGAAGCGCGGCGGCGGCCTCCACTGTGCAACTCGGGCATCCTCCTCT
                      ____________________________________________________________
consensus TAGCCCTTACCAGAGAAGCGCGGCGGCGGCCTCCACTCTGCAACTCCGGCATCCTCCTCT
 
. : . : . : . : . : . :
JMSF051J07+ GCCCATGCAAATCGAACAGCAACCCAGAGAACTCGAGATTAACATCACTGCTACTGAGAT
JMFF050G06+ GCCCATGCAAATCGAACAGCAACCCAGAGAACTCGAGATTAACATCACTGCTACTGAGAT
JMFS031F12+ GCCCATGCAAGTCGAGCAGCAACCCAGAGAACTGGAGGTTAACATCACTGCTACTGAGAT
                      ____________________________________________________________
consensus GCCCATGCAAATCGAACAGCAACCCAGAGAACTCGAGATTAACATCACTGCTACTGAGAT
 
. : . : . : . : . : . :
JMSF051J07+ ATCAACACCATAGACATCTGGAAAACCCTACCCGAAATCCTAAACCTTGAAAGAACTTGT
JMFF050G06+ ATCAACACCATAGACATCTGGAAAACCCTACCCGAAATCCTAAACCTTGAAAGAACTTGT
JMFS031F12+ ATCAACACCATAGACATCTGGAAAACCCTACCCGAAATCCTAAACCTTGAAAGAACTTGT
                      ____________________________________________________________
consensus ATCAACACCATAGACATCTGGAAAACCCTACCCGAAATCCTAAACCTTGAAAGAACTTGT
 
. : . : . : . : . : . :
JMSF051J07+ TAAAGGATATAAAATCAAGGATTCAACCCGAGAGCATAAGGAAATTGTTGAATTTAACCC
JMFF050G06+ TAAAGGATATAAAATCAAGGATTCAACCCGAGAGCATAAGGAAATTGTTGAATTTAACCC
JMFS031F12+ TAAAGGATATAAAATCAAGGATTCAACCCGAGAGCATAAGGAAATTGTTGAATTTAACGC
                      ____________________________________________________________
consensus TAAAGGATATAAAATCAAGGATTCAACCCGAGAGCATAAGGAAATTGTTGAATTTAACCC
 
. : . : . : . : . : . :
JMSF051J07+ AAATAGAGATGAATATTTGTGAGTCCAAGAAGAGTAGTATATACTAGTGAAATTTTGATG
JMFF050G06+ AAATAGAGATGAATATTTGTGAGTCCAAGAAGAGTAGTATATACTAGTGAAATTTTGATG
JMFS031F12+ AAATAGAGATGAATATTTGTGAGTCCAAGAAGAGTAGTATATACTAGTGAAATTTTGATG
                      ____________________________________________________________
consensus AAATAGAGATGAATATTTGTGAGTCCAAGAAGAGTAGTATATACTAGTGAAATTTTGATG
 
. : . : . : . : . : . :
JMSF051J07+ CTAGGGTTTGTTTGAGAGACA
JMFF050G06+ CTAGGGTTTGTTTGAGAGACA-TGAA-AATGGAAAAGCT-TTGAAGGAAAACTGTAGTCG
JMFS031F12+ CTAGGGTTTGTTTGAGAGACAGTGAAGAATGGAAAAGCTGTTGAAGGAGAACGGTAGTCG
                      ____________________________________________________________
consensus CTAGGGTTTGTTTGAGAGACAGTGAAGAATGGAAAAGCTGTTGAAGGAGAACTGTAGTCG
 
. : . : . : . : . : . :
JMFF050G06+ CCTCCGTGGGCGTTTTTGTAGCTTA
JMFS031F12+ CCTCCGTGGGCGTTTGTGTAGCTTAGTAGGGAGAACGGGGTTATGCGGGCAATTGGGCCC
                      ____________________________________________________________
consensus CCTCCGTGGGCGTTTTTGTAGCTTAGTAGGGAGAACGGGGTTATGCGGGCAATTGGGCCC