Previous Contig 003113:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021L02Sequence611003113 (7)pir|T48054|T480545e-19hypothetical protein F26K9.80 - Arabidopsis thaliana>gb:ATF26K9_1550112 Arabidop600003113 (7)pir|T48054|T480544e-19hypothetical protein F26K9.80 - Arabidopsis thaliana>gb:ATF26K9_1550112 Arabidop
JMFF048L04Sequence460003113 (7)pir|T48054|T480543e-16hypothetical protein F26K9.80 - Arabidopsis thaliana>gb:ATF26K9_1550112 Arabidop296003113 (7)
JMFN042I23Sequence575003113 (7)pir|T48054|T480544e-19hypothetical protein F26K9.80 - Arabidopsis thaliana>gb:ATF26K9_1550112 Arabidop
JMFN046L17Sequence590003113 (7)pir|T48054|T480544e-19hypothetical protein F26K9.80 - Arabidopsis thaliana>gb:ATF26K9_1550112 Arabidop
JMFS031E04Sequence505003113 (7)pir|T48054|T480549e-16hypothetical protein F26K9.80 - Arabidopsis thaliana>gb:ATF26K9_1550112 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048L04- GTG
                      ____________________________________________________________
consensus GTG
 
. : . : . : . : . : . :
rJMFF048L04- ACGAATTTGGAAGTACTAATTAAGATTATGAGTTTAGAATTACAGTAATTAATACACAGC
                      ____________________________________________________________
consensus ACGAATTTGGAAGTACTAATTAAGATTATGAGTTTAGAATTACAGTAATTAATACACAGC
 
. : . : . : . : . : . :
rJMFF048L04- GGTATTTATAGCATGCCAAATTTTTGCTAGCATTTAATGAGCTTGACTAATAAAAGCGGT
                      ____________________________________________________________
consensus GGTATTTATAGCATGCCAAATTTTTGCTAGCATTTAATGAGCTTGACTAATAAAAGCGGT
 
. : . : . : . : . : . :
rJMFF048L04- GAAAGGGAAGTAAGTGATAACGGCGTTATTTGACGGATATATTGCATCTTTTTTTTTTTT
                      ____________________________________________________________
consensus GAAAGGGAAGTAAGTGATAACGGCGTTATTTGACGGATATATTGCATCTTTTTTTTTTTT
 
. : . : . : . : . : . :
rJMFF048L04- TTACTGGATTGAAACAGAAAAATGAGTGGTGACAAGTGAAAAAGTTAATTTGTATAGTTT
JMFN042I23+ CAGAAAAATGAGTGGTGAAAAGTGAAAAAGTTAATTTGTATAGTTT
JMFN046L17+ CAGAAAAATGAGTGGTGAAAAGTGAAAAAGTTAATTTGTATAGTTT
rJMFF021L02- AATGAGTGGTGAAAAGTGAAAAAGTTAATTTGTATAGTTT
JMFF021L02+ CAGAAAAATGAGTGGTGAAAAGTGAAAAAGTTAATTNGTATAGTTT
                      ____________________________________________________________
consensus TTACTGGATTGAAACAGAAAAATGAGTGGTGAAAAGTGAAAAAGTTAATTTGTATAGTTT
 
. : . : . : . : . : . :
rJMFF048L04- TGTGTTTGGAAGGATTTTTACCCTAACGTCGACAAGTAATAGGGGTGGCGATT
JMFN042I23+ TGTGTTTGGAAGGATTTTTACCCTAACGTCGACAAGTAATAGGGGTGGCGATTCGCGGCG
JMFN046L17+ TGTGTTTGGAAGGATTTTTACCCTAACGTCGACAAGTAATAGGGGTGGCGATTCGCGGCG
rJMFF021L02- TGTGTTTGGAAGGATTTTTACCCTAACGTCGACAAGTAATAGGGGTGGCGATTCGCGGCG
JMFF021L02+ TGTGTTTGGAAGGATTTTTACCCTAACGTCGACAAGTAATAGGGGTGGCGATTCGCGGCG
                      ____________________________________________________________
consensus TGTGTTTGGAAGGATTTTTACCCTAACGTCGACAAGTAATAGGGGTGGCGATTCGCGGCG
 
. : . : . : . : . : . :
JMFN042I23+ GTGCATCACGGGGAACCAGTTGAGTTTGGCCGTGAGCTGCCAGCATAGATTTGTAGATCT
JMFN046L17+ GTGCATCACGGGGAACCAGTTGAGTTTGGCCGTGAGCTGCCAGCATAGATTTGTAGATCT
rJMFF021L02- GTGCATCACGGGGAACCAGTTGAGTTTGGCCGTGAGCTGCCAGCATAGATTTGTAGATCT
JMFF048L04+ CAGCATAGATTTGTAGATCT
JMFF021L02+ GTGCATCACGGGGAACCAGTTGAGTTTGGCCGTGAGCTGCCAGCATAGATTTGTAGATCT
JMFS031E04+ GCTGCCAGCATAGATTTGTAGATCT
                      ____________________________________________________________
consensus GTGCATCACGGGGAACCAGTTGAGTTTGGCCGTGAGCTGCCAGCATAGATTTGTAGATCT
 
. : . : . : . : . : . :
JMFN042I23+ GGACGAGCATCCTCTCGTCGTACTCCTTGAGTGGCCGGGCTCCGAAGCTGGCGACGGTGT
JMFN046L17+ GGACGAGCATCCTCTCGTCGTACTCCTTGAGTGGCCGGGCTCCGAAGCTGGCGACGGTGT
rJMFF021L02- GGACGAGCATCCTCTCGTCGTACTCCTTGAGTGGCCGGGCTCCGAAGCTGGCGACGGTGT
JMFF048L04+ GGACGAGCATCCTCTCGTCGTACTCCTTGAGTGGCCGGGCTCCGAAGCTGGCGACGGTGT
JMFF021L02+ GGACGAGCATCCTCTCGTCGTACTCCTTGAGTGGCCGGGCTCCGAAGCTGGCGACGGTGT
JMFS031E04+ GGACGAGCACTCTCTCGTCGTACTCCTTGAGTGGCCGGGCTCCGAAGCTGGCGACGGTGT
                      ____________________________________________________________
consensus GGACGAGCATCCTCTCGTCGTACTCCTTGAGTGGCCGGGCTCCGAAGCTGGCGACGGTGT
 
. : . : . : . : . : . :
JMFN042I23+ CGCCGGAGAAGCCACCCATGCCCATGCCGCCGCCGCCGCCGATGACGCGGGTGTTGGCGA
JMFN046L17+ CGCCGGAGAAGCCACCCATGCCCATGCCGCCGCCGCCGCCGATGACGCGGGTGTTGGCGA
rJMFF021L02- CGCCGGAGAAGCCACCCATGCCCATGCCGCCGCCGCCGCCGATGACGCGGGTGTTGGCGA
JMFF048L04+ CGCCGGAGAAGCCACCCATGCCCATGCCGCCGCCGCCGCCGATGACGCGGGTGTTGGCGA
JMFF021L02+ CGCCGGAGAAGCCACCCATGCCCATGCCGCCGCCGCCGCCGATGACGCGGGTGTTGGCGA
JMFS031E04+ CGCCGGAGAAGCCACCCATGCCCATGCCGCCGCCGCCGCCAATGACGCGGGTGTTGGCGA
                      ____________________________________________________________
consensus CGCCGGAGAAGCCACCCATGCCCATGCCGCCGCCGCCGCCGATGACGCGGGTGTTGGCGA
 
. : . : . : . : . : . :
JMFN042I23+ TCCTCAGCATCATGTTGACGTAGGCGTTGCGGAGGCGAATAAGCAGCTTTTTGGGAGAAA
JMFN046L17+ TCCTCAGCATCATGTTGACGTAGGCGTTGCGGAGGCGAATAAGCAGCTTTTTGGGAGAAA
rJMFF021L02- TCCTCAGCATCATGTTGACGTAGGCGTTGCGGAGGCGAATAAGCAGCTTTTTGGGAGAAA
JMFF048L04+ TCCTCAGCATCATGTTGACGTAGGCGTTGCGGAGGCGAATAAGCAGCTTTTTGGGAGAAA
JMFF021L02+ TCCTCAGCATCATGTTGACGTAGGCGTTGCGGAGGCGAATAAGCAGCTTTTTGGGAGAAA
JMFS031E04+ TCCTCAGCATCATGTTGACGTAGGCGTTGCGGAGGCGAATAAGCAGCTTTTTGGGAGAAA
                      ____________________________________________________________
consensus TCCTCAGCATCATGTTGACGTAGGCGTTGCGGAGGCGAATAAGCAGCTTTTTGGGAGAAA
 
. : . : . : . : . : . :
JMFN042I23+ ATCGGAGGTTGAAATTGAGCTTGATCTTGGGCGTGAGCTTTATCCTCCACGACGGTTTCT
JMFN046L17+ ATCGGAGGTTGAAATTGAGCTTGATCTTGGGCGTGAGCTTTATCCTCCACGACGGTTTCT
rJMFF021L02- ATCGGAGGTTGAAATTGAGCTTGATCTTGGGCGTGAGCTTTATCCTCCACGACGGTTTCT
JMFF048L04+ ATCGGAGGTTGAAATTGAGCTTGATCTTGGGCGTGAGCTTTATCCTCCACGACGGTTTCT
JMFF021L02+ ATCGGAGGTTGAAATTGAGCTTGATCTTGGGCGTGAGCTTTATCCTCCACGACGGTTTCT
JMFS031E04+ ATCGGAGGTTGAAATTGAGCTTGATCTTGGGCGTGAGCTTTATCCTCCACGACGGTTTCT
                      ____________________________________________________________
consensus ATCGGAGGTTGAAATTGAGCTTGATCTTGGGCGTGAGCTTTATCCTCCACGACGGTTTCT
 
. : . : . : . : . : . :
JMFN042I23+ TCCGGCCGCTAGCTCCGTCTCCGGTATCAAACTTCCTTCTCCGGCCGCCGCGGCTTATCC
JMFN046L17+ TCCGGCCGCTAGCTCCGTCTCCGGTATCAAACTTCCTTCTCCGGCCGCCGCGGCTTATCC
rJMFF021L02- TCCGGCCGCTAGCTCCGTCTCCGGTATCAAACTTCCTTCTCCGGCCGCCGCGGCTTATCC
JMFF048L04+ TCCGGCCGCTAGCTCCGTCTCCGGTATCAAACTTCCTTCTCTGGCCGCCGCGGCTTATCC
JMFF021L02+ TCCGGCCGCTAGCTCCGTCTCCGGTATCAAACTTCCTTCTCCGGCCGCCGCGGCTTATCC
JMFS031E04+ TCCGGCCGCTAGCTCCGTCTCCGGTATCAAACTTCCTTCTCCGGCCGCCGCGGCTTATCC
                      ____________________________________________________________
consensus TCCGGCCGCTAGCTCCGTCTCCGGTATCAAACTTCCTTCTCCGGCCGCCGCGGCTTATCC
 
. : . : . : . : . : . :
JMFN042I23+ TCTCGTATCCCTTCCTCTTCGTCTTCCAGTACTGCTTTATCCCGTTGTATACATTAACAG
JMFN046L17+ TCTCGTATCCCTTCCTCTTCGTCTTCCAGTACTGCTTTATCCCGTTGTATACATTAACAG
rJMFF021L02- TCTCGTATCCCTTCCTCTTCGTCTTCCAGTACTGCTTTATCCCGTTGTATACATTAACAG
JMFF048L04+ TCTCGTATCCCTTCCTCTTCGTCTTCCAGTACTGCTTTATCCCGTTGTATACATTAACAG
JMFF021L02+ TCTCGTATCCCTTCCTCTTCGTCTTCCAGTACTGCTTTATCCCGTTGTATACATTAACAG
JMFS031E04+ TCTCGTATCCCTTCCTCTTCGTCTTCCAGTACTGCTTTATCCCGTTGTATACATTAACAG
                      ____________________________________________________________
consensus TCTCGTATCCCTTCCTCTTCGTCTTCCAGTACTGCTTTATCCCGTTGTATACATTAACAG
 
. : . : . : . : . : . :
JMFN042I23+ ACACCCCTTCCATTCCCCTCCCGGATCACGATCTCGTAACCGCCTTATC
JMFN046L17+ ACACCCCTTCCATTCCCCTCCCGGATCACGATCTCGTAACCGCCTTATCTCTTCAAC
rJMFF021L02- ACACCCCTTCCATTCCCCTCCCGGATCACGATCTCGTAACCGCCTTATCTCTTCAACTCC
JMFF048L04+ ACACCCCTTCCATTCCCCTCCCGGATCACGATCTCGTAACCGCCTTATCTCTTCAACTCC
JMFF021L02+ ACACCCCTTCCATTCCCCTCCCGGATCACGATCTCGTAACCGCCTTATCTCTTCAACTCC
JMFS031E04+ ACACCCCTTCCATTCCCCTCCCGGATCACGATCTCGTAACCGCCTTATCTCTTCAACTCC
                      ____________________________________________________________
consensus ACACCCCTTCCATTCCCCTCCCGGATCACGATCTCGTAACCGCCTTATCTCTTCAACTCC
 
. : . : . : . : . : . :
rJMFF021L02- CCTCAGATTCTCAGAACATT
JMFF048L04+ CCTCAGATTCTCAGAACATT
JMFF021L02+ CCTCAGATTCTCAGAACATT
JMFS031E04+ CCTCAGATTCTCAGAACATTGAATGTTGCGTATAAACGAAGACGAGAAATATAGGAATTT
                      ____________________________________________________________
consensus CCTCAGATTCTCAGAACATTGAATGTTGCGTATAAACGAAGACGAGAAATATAGGAATTT