Previous Contig 003109:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041G16Sequence620002026 (2)gb:AY124861_15802262e-09Arabidopsis thaliana AT5g60580/muf9_230 mRNA, complete cds.>gb:AF367330_1791782 634003109 (4)gb:AB011483_15115114e-25Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUF9.
JMFF047I17Sequence491002026 (2)gb:AY124861_15802260.002Arabidopsis thaliana AT5g60580/muf9_230 mRNA, complete cds.>gb:AF367330_1791782 314003109 (4)
JMFS031B03Sequence423003109 (4)
JMFS039B11Sequence574003109 (4)gb:AB011483_15115112e-16Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUF9.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF041G16+ GCCATATCGCTGCCCTTTCATGTGTACTCGGCCTCCTTGGATCTATGA
                      ____________________________________________________________
consensus GCCATATCGCTGCCCTTTCATGTGTACTCGGCCTCCTTGGATCTATGA
 
. : . : . : . : . : . :
rJMFF041G16+ CATCTTCGACAATGGTAAAGAGAAGATTTGTATGGGTGTATGCATCAGTCCAGTTTGCAT
JMFS039B11+ TTTGTATGGGTGTATGCATCAGTCCAGTTTGCAT
                      ____________________________________________________________
consensus CATCTTCGACAATGGTAAAGAGAAGATTTGTATGGGTGTATGCATCAGTCCAGTTTGCAT
 
. : . : . : . : . : . :
rJMFF041G16+ TTGTGGTGCTCTTTGCACATATTTTCTACTCTCTGGTTCATGTGCAAGCAGTTCTGTCGA
JMFS039B11+ TTGTGGTGCTCTTTGCACATATTTTCTACTCTCTGGTTCATGTGCAAGCAGTTCTGTCGA
                      ____________________________________________________________
consensus TTGTGGTGCTCTTTGCACATATTTTCTACTCTCTGGTTCATGTGCAAGCAGTTCTGTCGA
 
. : . : . : . : . : . :
rJMFF041G16+ TTCTTCTCTCCACATTTGCGGGGTTTGGTGTTGCAATGAGTGGAAGTTCCATTCTTGTCG
JMFS039B11+ TTCTTCTCTCCACATTTGCGGGGTTTGGTGTTGCAATGAGTGGAAGTTCCATTCTTGTCG
JMFS031B03+ TCG
                      ____________________________________________________________
consensus TTCTTCTCTCCACATTTGCGGGGTTTGGTGTTGCAATGAGTGGAAGTTCCATTCTTGTCG
 
. : . : . : . : . : . :
rJMFF041G16+ AGTACTTCAGATGGCGAAGAAGGCGGCGCGTTTTGTTACACCGCCAAGAGAATCCTCAAG
JMFS039B11+ AGTACTTCAGATGGCGAAGAAGGCGGCGCGTTTTGTTACACCGCCAAGAGAATCCTCAAG
JMFS031B03+ AGTACTTCAGATGGCGAAGAAGGCGGCGCGTTTTGTTACACCGCCAAGAGAATCCTCAAG
                      ____________________________________________________________
consensus AGTACTTCAGATGGCGAAGAAGGCGGCGCGTTTTGTTACACCGCCAAGAGAATCCTCAAG
 
. : . : . : . : . : . :
rJMFF041G16+ TCGCGCTACCTCCAGGGCGGTGGCCGCCACAGCCAAACCAAACAGTAACAGCAACAGCAA
JMFS039B11+ TCGCGCTACCTCCAGGGCGGTGGCCGCCACAGCCAAACCAAACAGTAACAGCAACAGCAA
rJMFF047I17+ TAACAGCAACAGCAA
JMFS031B03+ TCGCGCTACCTCCAGGGCGGTGGCCGCCACAGCCAAACCAAACAGTAACAGCAACAGCAA
                      ____________________________________________________________
consensus TCGCGCTACCTCCAGGGCGGTGGCCGCCACAGCCAAACCAAACAGTAACAGCAACAGCAA
 
. : . : . : . : . : . :
rJMFF041G16+ CAACAACATCGCAGGTCGGTCCTCAACATCATCAGACCGACATAGAAAATCCAGAAACAT
JMFS039B11+ CAACAACATCGCAGGTCGGTCCTCAACATCATCAGACCGACATAGAAAATCCAGAAACAT
rJMFF047I17+ CAACAACATCGCAGGTCGGTCCTCAACATCATCAGACCGACATAGAAAATCCAGAAACAT
JMFS031B03+ CAACAACATCGCAGGTCGGTCCTCAACATCATCAGACCGACATAGAAAATCCAGAAACAT
                      ____________________________________________________________
consensus CAACAACATCGCAGGTCGGTCCTCAACATCATCAGACCGACATAGAAAATCCAGAAACAT
 
. : . : . : . : . : . :
rJMFF041G16+ TTAGTGGGAGCTAGTTGAAGTTGAAGCATTAGGATGGGAAGGTGTGATGTAGCAAAGATA
JMFS039B11+ TTAGTGGGAGCTAGTTGAAGTTGAAGCATTAGGATGGGAAGGTGTGATGTAGCAAAGATA
rJMFF047I17+ TTAGTGGGAGCTAGTTGAAGTTGAAGCATTAGGATGGGAAGGTGTGATGTAGCAAAGATA
JMFS031B03+ TTAGTGGGAGCTAGTTGAAGTTGAAGCATTAGGATGGGAAGGTGTGATGTAGCAAAGATA
                      ____________________________________________________________
consensus TTAGTGGGAGCTAGTTGAAGTTGAAGCATTAGGATGGGAAGGTGTGATGTAGCAAAGATA
 
. : . : . : . : . : . :
rJMFF041G16+ GAGAGTAATATGGAAAAATACAACAAGGGGTTTTGTTCATTGCTCCACCTTAGCTTGTAC
JMFS039B11+ GAGAGTAATATGGAAAAATACAACAAGGGGTTTTGTTCATTGCTCCACCTTAGCTTGTAC
rJMFF047I17+ GAGAGTAATATGGAAAAATACAGCAAGGGGTTTTGTTCATTGCTCCACCTTAGCTTGTAC
JMFS031B03+ GAGAGTAATATGGAAAAATACAACAAGGGGTTTTGTTCATTGCTCCACCTTAGCTTGTAC
                      ____________________________________________________________
consensus GAGAGTAATATGGAAAAATACAACAAGGGGTTTTGTTCATTGCTCCACCTTAGCTTGTAC
 
. : . : . : . : . : . :
rJMFF041G16+ ATTGTTCCTTCTGCATAATTGTAATATTGCAGTGTTGTGAAAAAGAAAGTTTGAGTGATG
JMFS039B11+ ATTGTTCCTTCTGCATAATTGTAATATTGCAGTGTTGTGAAAAAGAAAGTTTGAGTGATG
rJMFF047I17+ ATTGTTCCTTCTGCATAATTGTAATATTGCAGTGTTGTGAAAAAGAAAGTTTGAGTGATG
JMFS031B03+ ATTGTTCCTTCTGCATAATTGTAATATTGCAGTGTTGTGAAAAAGAAAGTTTGAGTGATG
                      ____________________________________________________________
consensus ATTGTTCCTTCTGCATAATTGTAATATTGCAGTGTTGTGAAAAAGAAAGTTTGAGTGATG
 
. : . : . : . : . : . :
rJMFF041G16+ AGTATACATACATTATACAT
JMFS039B11+ AGTATACATACATTATACAT
rJMFF047I17+ AGTATACATACATTATACAT
JMFS031B03+ AGTATACATACATTATACATXXXXXXXXXXXXXXXXXXXXXXCCCGAGACTAGTTCTCTC
                      ____________________________________________________________
consensus AGTATACATACATTATACATNNNNNNNNNNNNNNNNNNNNNNCCCGAGACTAGTTCTCTC