Previous Contig 003099:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002D13Sequence351000097 (22)sp|P35016|ENPL_CATRO1e-34Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -776003099 (25)sp|P35016|ENPL_CATRO6e-74Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF002J08Sequence234000097 (22)sp|P35016|ENPL_CATRO4e-33Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -558003099 (25)sp|P35016|ENPL_CATRO6e-62Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF002K07Sequence573000097 (22)sp|P35016|ENPL_CATRO6e-61Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -695003099 (25)gb:ATAC002343_15427651e-49Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMFF004F13Sequence442000097 (22)sp|P35016|ENPL_CATRO7e-50Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -773003099 (25)gb:AF239931_17799672e-64Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMFF004G14Sequence553000097 (22)sp|P35016|ENPL_CATRO3e-59Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -728003099 (25)sp|P35016|ENPL_CATRO9e-58Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF005J09Sequence445000097 (22)sp|P35016|ENPL_CATRO2e-46Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -727003099 (25)sp|P35016|ENPL_CATRO1e-67Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF007I17Sequence622000097 (22)sp|P35016|ENPL_CATRO1e-66Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -776003099 (25)sp|P35016|ENPL_CATRO4e-74Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF027M12Sequence248000097 (22)sp|P35016|ENPL_CATRO7e-16Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -682003099 (25)gb:ATAC002343_15427653e-54Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMFF034G18Sequence547000097 (22)sp|P35016|ENPL_CATRO1e-56Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -785003099 (25)sp|P35016|ENPL_CATRO1e-70Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF034L02Sequence522003099 (25)gb:AF239931_17799671e-32Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMFF036O09Sequence563000097 (22)sp|P35016|ENPL_CATRO5e-61Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -762003099 (25)gb:AF239931_17799673e-57Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMFF041G02Sequence643000097 (22)sp|P35016|ENPL_CATRO8e-76Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -599003099 (25)sp|P35016|ENPL_CATRO6e-37Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFN010N19Sequence614003099 (25)sp|P35016|ENPL_CATRO8e-91Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFS029H11Sequence387003099 (25)
JMFS048G05Sequence579003099 (25)gb:AF239931_17799672e-27Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMFS052A06Sequence483003099 (25)gb:AF239931_17799672e-64Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMSF002I20Sequence359000097 (22)sp|P35016|ENPL_CATRO1e-35Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -736003099 (25)gb:AF239931_17799672e-65Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMSF006C15Sequence235000097 (22)sp|P35016|ENPL_CATRO1e-16Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -334003099 (25)
JMSF007C15Sequence177000097 (22)sp|P35016|ENPL_CATRO3e-07Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -805003099 (25)gb:AF239931_17799672e-64Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMSF007F18Sequence428000097 (22)sp|P35016|ENPL_CATRO1e-48Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -767003099 (25)sp|P35016|ENPL_CATRO1e-67Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMSF011N14Sequence353000097 (22)sp|P35016|ENPL_CATRO1e-34Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -747003099 (25)sp|P35016|ENPL_CATRO3e-67Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMSF013O12Sequence420003099 (25)sp|P35016|ENPL_CATRO2e-54Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -744003099 (25)gb:ATAC002343_15427654e-69Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMSF030I09Sequence646000097 (22)sp|P35016|ENPL_CATRO2e-76Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -714003099 (25)gb:AF239931_17799676e-62Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMSF040G08Sequence688000097 (22)sp|P35016|ENPL_CATRO3e-84Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -906003099 (25)gb:AF239931_17799672e-90Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF013O12- GTGTCTTTATCTCAGATGAATTTGATG
                      ____________________________________________________________
consensus GTGTCTTTATCTCAGATGAATTTGATG
 
. : . : . : . : . : . :
JMSF013O12- AATTGTTACCAAAATACTTGAACTTTCTGTTGGGTCTTGTTGACTCTGACACTCTACCAC
                      ____________________________________________________________
consensus AATTGTTACCAAAATACTTGAACTTTCTGTTGGGTCTTGTTGACTCTGACACTCTACCAC
 
. : . : . : . : . : . :
JMSF013O12- TGAATGTCTCAAGAGAAATGCTTCAACAACACAGCAGCTTAAGAACAATCAAGAAGAAAC
                      ____________________________________________________________
consensus TGAATGTCTCAAGAGAAATGCTTCAACAACACAGCAGCTTAAGAACAATCAAGAAGAAAC
 
. : . : . : . : . : . :
JMSF013O12- TCATCCGCAAAGCCCTTGATATGATCCGCAGACTTGCTGATGAGGATCCAGATGAATCAA
JMFN010N19- TTGCTGATGAGGATCCAGATGAATCAA
                      ____________________________________________________________
consensus TCATCCGCAAAGCCCTTGATATGATCCGCAGACTTGCTGATGAGGATCCAGATGAATCAA
 
. : . : . : . : . : . :
JMSF013O12- GTGACAAGGACAAAAAAGATGTTGAGGAATCTGGTGATGAAAATGAGAAGAAAGGTCAAT
JMFN010N19- GTGACAAGGACAAAAAAGATGTTGAGGAATCTGGTGATGAAAATGAGAAGAAAGGTCAAT
                      ____________________________________________________________
consensus GTGACAAGGACAAAAAAGATGTTGAGGAATCTGGTGATGAAAATGAGAAGAAAGGTCAAT
 
. : . : . : . : . : . :
JMSF013O12- ATGCAAAATTCTGGAATGAGTTTGGAAAGTCAATAAAGCTTGGAATTATAGAGGACGCAA
JMFN010N19- ATGCAAAATTCTGGAATGAGTTTGGAAAGTCAATAAAGCTTGGAATTATAGAGGACGCAA
                      ____________________________________________________________
consensus ATGCAAAATTCTGGAATGAGTTTGGAAAGTCAATAAAGCTTGGAATTATAGAGGACGCAA
 
. : . : . : . : . : . :
JMSF013O12- CTAACCGGAACCGTTTAGCTAAACTTCTTCGTTTCGAGACCACAAAGTCAGATGGTAAAC
JMFN010N19- CTAACCGGAACCGTTTAGCTAAACTTCTTCGTTTCGAGACCACAAAGTCAGATGGTAAAC
                      ____________________________________________________________
consensus CTAACCGGAACCGTTTAGCTAAACTTCTTCGTTTCGAGACCACAAAGTCAGATGGTAAAC
 
. : . : . : . : . : . :
JMSF013O12- TAACCTCACTAGATCAGTACATCTCAAGGATGA
JMFN010N19- TAACCTCACTAGATCAGTACATCTCAAGGATGAAAGCAAACCAGAAGGACATCTTCTACA
                      ____________________________________________________________
consensus TAACCTCACTAGATCAGTACATCTCAAGGATGAAAGCAAACCAGAAGGACATCTTCTACA
 
. : . : . : . : . : . :
JMFN010N19- TTACAGGAACAAGCAAAGAACAGTTGGAGAAATCTCCCTT-CCTTGAGGGGCTTAAAAAG
rJMSF040G08+ AAAGAACAGTTGGAGAAATCTCCCTTCCCTTGAGGGGCTTAAAAAG
                      ____________________________________________________________
consensus TTACAGGAACAAGCAAAGAACAGTTGGAGAAATCTCCCTTCCCTTGAGGGGCTTAAAAAG
 
. : . : . : . : . : . :
JMFN010N19- AAAAACTATGAGGTCATTTTCTTCACAGATCCTGTGGATGAATACCTGATGCAGTATTTG
rJMSF007C15+ AGTATTTG
rJMFF007I17+ CCTGATGCAGTATTTG
rJMFF002D13+ CCTGATGCAGTATTTG
rJMSF040G08+ AAAAACTATGAGGTCATTTTCTTCACAGATCCTGTGGATGAATACCTGATGCAGTATTTG
                      ____________________________________________________________
consensus AAAAACTATGAGGTCATTTTCTTCACAGATCCTGTGGATGAATACCTGATGCAGTATTTG
 
. : . : . : . : . : . :
JMFN010N19- ATGGATTATGAAGATAAGAAATT-CCAGGATGTGTCCAAAGAGGG-TCTGAAGATTAAGG
rJMSF007C15+ ATGGATTATGAAGATAAGAAATT-CCAGGATGTGTCCAAAGAGGN-TCTGAAGATTAAGG
rJMFF007I17+ ATGGATTATGAAGATAAGAAATTCCCAGGATGTGTCCAAAGAGGG-TCTGAAGATTAAGG
rJMFF005J09+ TCCAAAGAGGGTTCTGAAGATTAAGG
rJMFF002D13+ ATGGATTATGAAGATAAGAAATTCCCAGGATGTGTCCAAAGAGGG-TCTGAAGATTAAGG
rJMSF011N14+ TTAAGG
rJMSF013O12+ TGTCCAAAGAGGG-TTTGAAGATTAAGG
rJMSF040G08+ ATGGATTATGAAGATAAGAAATT-CCAGGATGTGTCCAAAGAGGG-TCTGAAGATTAAGG
rJMFF034G18+ ATT-CCAGGATGTGTCCAAAGAGGN-TCTGAAGATTAAGG
rJMFF004F13+ CCAAAGAGGN-TNTGAAGATTAAGG
rJMFF036O09+ AAGATTAAGG
rJMSF007F18+ GG-TCTGAAGATTAAGG
                      ____________________________________________________________
consensus ATGGATTATGAAGATAAGAAATT-CCAGGATGTGTCCAAAGAGGG-TCTGAAGATTAAGG
 
. : . : . : . : . : . :
JMFN010N19- ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMSF007C15+ ATTCAAAAGNCAAAGAATNGAAGGAATCATTC-AAAGACTTANCCAAATGGTGGAAAGGT
rJMFF007I17+ ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMFF005J09+ ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMFF002J08+ CAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
JMFS052A06- ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMFF002D13+ ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMSF011N14+ ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMSF030I09+ TTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMSF002I20+ AAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMSF013O12+ ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMSF040G08+ ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMFF034G18+ ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMFF004F13+ ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMFF036O09+ ATTCAAAAGCCAAAGAATTGAAGGAATCATTCAAAAGACTTAACCAAATGGTGGAAAGGT
rJMFF004G14+ GAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
rJMSF007F18+ ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
                      ____________________________________________________________
consensus ATTCAAAAGCCAAAGAATTGAAGGAATCATTC-AAAGACTTAACCAAATGGTGGAAAGGT
 
. : . : . : . : . : . :
JMFN010N19- GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMSF007C15+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMFF007I17+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMFF005J09+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMFF002J08+ GCCTTGNCCAGTGACAATGTTGATGAAGTGAAAATTAGCAN-CCGTTTGGCTGACA-CCC
JMFS052A06- GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMFF002D13+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMSF011N14+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMSF030I09+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMSF002I20+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMSF013O12+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMSF040G08+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMFF034G18+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMFF027M12+ CAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMFF004F13+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMFF036O09+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACACCCC
rJMFF004G14+ GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMSF007F18+ GCCTTGGCCAGTGACAATGTTGATGGAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
rJMFF002K07+ CAATGTTGATGAAGTGAAAATTAGCAACCCGTTTGGCTGACA-CCC
                      ____________________________________________________________
consensus GCCTTGGCCAGTGACAATGTTGATGAAGTGAAAATTAGCAA-CCGTTTGGCTGACA-CCC
 
. : . : . : . : . : . :
JMFN010N19- CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATC
rJMSF007C15+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMFF007I17+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMFF005J09+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMFF002J08+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTNGGAGTGCAAACATGGAGAGAATCATGCAA
JMFS052A06- CCTGAGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMFF034L02+ GTGCAAACANGGAGAGANTCATGCAA
rJMFF002D13+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMSF011N14+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMSF030I09+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMSF002I20+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMSF013O12+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMSF040G08+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMFF034G18+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMFF027M12+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMFF004F13+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMFF036O09+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMFF004G14+ CCTGTGTTGTGGTAACATCGAAGTACCGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMSF007F18+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMFF002K07+ CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
rJMFF041G02+ ATGCAA
                      ____________________________________________________________
consensus CCTGTGTTGTGGTAACATCGAAGTA-CGGTTGGAGTGCAAACATGGAGAGAATCATGCAA
 
. : . : . : . : . : . :
rJMSF007C15+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMFF007I17+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMFF005J09+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMFF002J08+ TCACAANCNTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
JMFS052A06- TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMFF034L02+ TCACAAACCTTATCAGATGCCTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMFF002D13+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMSF011N14+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMSF030I09+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMSF002I20+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMSF013O12+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMSF040G08+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMFF034G18+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMFF027M12+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMFF004F13+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMFF036O09+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMFF004G14+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMSF007F18+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
JMFS048G05- GCAAGCAAGCATNTATGCGTGGAAAGAGGGTGCTTGA
rJMFF002K07+ TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
rJMFF041G02+ TCCCAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
                      ____________________________________________________________
consensus TCACAAACCTTATCAGATG-CTAGCAAGCAGGCATATATGCGTGGAAAGAGGGTGCTTGA
 
. : . : . : . : . : . :
rJMSF007C15+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMFF007I17+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMFF005J09+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMFF002J08+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGNGAGAGAGTAGTAAAGGACCCAGA
JMFS052A06- GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAAA
rJMFF034L02+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTNCGTGAGAGAGTAGTAAAGGACCCAGA
rJMFF002D13+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMSF011N14+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMSF030I09+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMSF002I20+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMSF013O12+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMSF040G08+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMFF034G18+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMFF027M12+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMFF004F13+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMFF036O09+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMFF004G14+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMSF007F18+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
JMFS048G05- AATCAATCCTCATCACCCGATCATCANGGAGCTCCGAGAGAGAGTAGTAAAGGACCCNNA
rJMFF002K07+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
rJMFF041G02+ GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGCCCCAGA
                      ____________________________________________________________
consensus GATCAATCCTCGTCACCCGATCATCAAGGAGCTCCGTGAGAGAGTAGTAAAGGACCCAGA
 
. : . : . : . : . : . :
rJMSF007C15+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCCCTCATGGAGAGTGG
rJMFF007I17+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMFF005J09+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMFF002J08+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATNTACAAAACCGCTCTCATGGAGAGTGG
JMFS052A06- GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMFF034L02+ GGANGAGAGTACAAAGGAAACAGCACANCTNATATACAAAACCGCTCTCATGGAGAGTGG
rJMFF002D13+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMSF011N14+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMSF030I09+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMSF002I20+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMSF013O12+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMSF040G08+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMFF034G18+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMFF027M12+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMFF004F13+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMFF036O09+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMFF004G14+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMSF007F18+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
JMFS048G05- GGATGAGAGTCCAANGGAACCAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMFF002K07+ GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
rJMFF041G02+ GGATGAGAGTCCAAAGGAAACAGCCCAGCTTATTTACAAAACCGCTTTCATGGAGAGTGG
                      ____________________________________________________________
consensus GGATGAGAGTACAAAGGAAACAGCACAGCTTATCTACAAAACCGCTCTCATGGAGAGTGG
 
. : . : . : . : . : . :
rJMSF007C15+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMFF007I17+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMFF005J09+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMFF002J08+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTNGTATNTACANCTCTGTCAAGTCCAG
JMFS052A06- CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMFF034L02+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMFF002D13+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMSF011N14+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMSF006C15+ CAACTCTGTCAAGTCCAG
rJMSF030I09+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMSF002I20+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMSF013O12+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMSF040G08+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMFF034G18+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMFF027M12+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMFF004F13+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMFF036O09+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMFF004G14+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMSF007F18+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
JMFS048G05- CTTCNACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACNACTCTGTCAAGTCCAG
rJMFF002K07+ CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
rJMFF041G02+ GTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTGGTATTTACAACTCTGTCAAGTCCAG
JMFS029H11- CCTCTCGTATCTACAACTCTGTCAAGTCCAG
                      ____________________________________________________________
consensus CTTCAACGTCCCTGACCCAAAGGATTTTGCCTCTCGTATCTACAACTCTGTCAAGTCCAG
 
. : . : . : . : . : . :
rJMSF007C15+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMFF007I17+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMFF005J09+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMFF002J08+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGANGAAGTTGAAGAAGAGGCCGA
JMFS052A06- TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMFF034L02+ TCTCAACATCAGCCCNGACGCTGTGGTTGAGGAAGACGANGAAGTTGAAGAAGAGGCCGA
rJMFF002D13+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMSF011N14+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMSF006C15+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMSF030I09+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMSF002I20+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMSF013O12+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTG---AAGAGGCCGA
rJMSF040G08+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMFF034G18+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMFF027M12+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMFF004F13+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMFF036O09+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMFF004G14+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMSF007F18+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
JMFS048G05- TCTCAACATCNGCCCTGACGCTGTGGTTGAGGAANACTACGAAGTTGAAGAAGAGGCCGA
rJMFF002K07+ TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
rJMFF041G02+ TTTCAACATCAGCCCTGACGCTGTGGTTGAGGAAAACGACGAAGTTGAAAAAAAGGCCGA
JMFS029H11- TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
                      ____________________________________________________________
consensus TCTCAACATCAGCCCTGACGCTGTGGTTGAGGAAGACGACGAAGTTGAAGAAGAGGCCGA
 
. : . : . : . : . : . :
rJMSF007C15+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMFF007I17+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATNGTG-CTGATGGAA
rJMFF005J09+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMFF002J08+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
JMFS052A06- AACCAGCT
rJMFF034L02+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTGCCTGATGGAA
rJMFF002D13+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMSF011N14+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMSF006C15+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMSF030I09+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMSF002I20+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMSF013O12+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMSF040G08+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMFF034G18+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMFF027M12+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMFF004F13+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMFF036O09+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMFF004G14+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMSF007F18+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
JMFS048G05- AACCAGCTCAAAAGAAGCNGAGTCTTACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMFF002K07+ AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
rJMFF041G02+ AACCAGCTCAAAAAAAGCAGAGTTTAACCCAGAAAACGCAAAAAATGGTG-CTGATGGAA
JMFS029H11- AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
                      ____________________________________________________________
consensus AACCAGCTCAAAAGAAGCAGAGTCTAACCCAGAAAACGCAGAAGATGGTG-CTGATGGAA
 
. : . : . : . : . : . :
rJMSF007C15+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMFF007I17+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMFF005J09+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMFF002J08+ TCAAGGATGAGTTATAGATTATCCTGAAGAACAA
rJMFF034L02+ TCAAGGATGAGTTATAGATTATCTNGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMFF002D13+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMSF011N14+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMSF006C15+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMSF030I09+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMSF002I20+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMSF013O12+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMSF040G08+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMFF034G18+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMFF027M12+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMFF004F13+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMFF036O09+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMFF004G14+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMSF007F18+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
JMFS048G05- TCAAGGATGAGTTATANATTATCTTGAAGAACCAGTCTTCTGTGACTAGCTTGTTTATTG
rJMFF002K07+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
rJMFF041G02+ TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTTTTTTGTGACTAGCTTGTTTATTG
JMFS029H11- TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
                      ____________________________________________________________
consensus TCAAGGATGAGTTATAGATTATCTTGAAGAACAAGTCTTCTGTGACTAGCTTGTTTATTG
 
. : . : . : . : . : . :
rJMSF007C15+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMFF007I17+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMFF005J09+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMFF034L02+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCAGTAA
rJMFF002D13+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMSF011N14+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGATGATACTAGTTTGCTGTAA
rJMSF006C15+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMSF030I09+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMSF002I20+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMSF013O12+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMSF040G08+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMFF034G18+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMFF027M12+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMFF004F13+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMFF036O09+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMFF004G14+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMSF007F18+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
JMFS048G05- CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMFF002K07+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
rJMFF041G02+ CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
JMFS029H11- CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
                      ____________________________________________________________
consensus CAGTCCTAAAAAGACTAACGAAGAACCCCAAGTGTTAGAGTTGATACTAGTTTGCTGTAA
 
. : . : . : . : . : . :
rJMSF007C15+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
rJMFF007I17+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTA
rJMFF005J09+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTA
rJMFF034L02+ ACACATTTACCAGGAA
rJMFF002D13+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTA
rJMSF011N14+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
rJMSF006C15+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCACCTCGGTATGGTAGCGGTTN
rJMSF030I09+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTACCGGTTT
rJMSF002I20+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
rJMSF013O12+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTACCGGTTT
rJMSF040G08+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
rJMFF034G18+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
rJMFF027M12+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
rJMFF004F13+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
rJMFF036O09+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
rJMFF004G14+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
rJMSF007F18+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
JMFS048G05- ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CATCGTATGGTA-CGGTTT
rJMFF002K07+ ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
rJMFF041G02+ ACACATTTACCAGGAATTTTGTCTTTTAAATTTCTTTTCA-CTCGGTATGGGA-CGGTTT
JMFS029H11- ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
                      ____________________________________________________________
consensus ACACATTTACCAGGAATTTTGTCTTCTAAATTTCTTTTCA-CTCGGTATGGTA-CGGTTT
 
. : . : . : . : . : . :
rJMSF007C15+ TA-CGCTGCTTAGTCTTTGTGCAATGCT
rJMSF011N14+ TA-CGCTGCTTAGTCTTTGTGCAATGCTTG
rJMSF006C15+ TACCGCTGCTTAGTCTT
rJMSF030I09+ TACCGCTGCTTAGTCTTTGTGCAATGCTTG
rJMSF002I20+ TA-CGCTGCTTAGTCTTTGTGCAATGCTTG
rJMSF013O12+ TA-CGCTG
rJMSF040G08+ TA-CGCTGCTTAGTCTTTGTGCAATGCTTG
rJMFF034G18+ TA-CGCTGCTTAGTCTTTGTGCAATGCTTTGCTATG
rJMFF027M12+ TA-CGCTGCTTAGTCTTTGTGCAATGCTTTGCTATGCT
rJMFF004F13+ TA-CGCTGCTTAGTCTTTGTGCAATGCTTTGCTATGCT
rJMFF036O09+ TA-CGCTGCTTAGTCTTTGTGCAATGCTTTGCTATGCTA
rJMFF004G14+ TA-CGCTGCTTAGTCTTTGTGCAATGCTTTGCTATGCTA
rJMSF007F18+ TA-CGCTGCTTAGTCTTTGTGCAATGCTTTGCTATGCTAT
JMFS048G05- TA-C
rJMFF002K07+ TA-CGCTGCTTAGTCTTTGTGCAATGCTTTGCTATGCTATGTAA
rJMFF041G02+ TA-CGCTGCTTAGTCTTTGTGCAATGCTTTGCTATGCTATGTAAAATCATAATTTTGT
JMFS029H11- TA-CGCTGCTTAGTCTTTGTGCAATGCTTTGCTATGCTATGTAATATCATAATTTTGTTT
                      ____________________________________________________________
consensus TA-CGCTGCTTAGTCTTTGTGCAATGCTTTGCTATGCTATGTAATATCATAATTTTGTTT