Previous Contig 003097:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049L23Sequence439003097 (3)gb:BT006372_16392596e-24Arabidopsis thaliana At3g08610 gene, complete cds.483003097 (3)gb:BT006372_16392598e-24Arabidopsis thaliana At3g08610 gene, complete cds.
JMFS029F11Sequence524003097 (3)gb:BT006372_16392591e-23Arabidopsis thaliana At3g08610 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF049L23- GGCCCTTATGGCGGATCTACCTGGAGAGTTTTTTTTTTTTTTTTGGAATTGCAGTGACTG
JMFF049L23+ AATTGCAGTGACTG
JMFS029F11+ TTTTTTGAAATTGCAGTGACTG
                      ____________________________________________________________
consensus GGCCCTTATGGCGGATCTACCTGGAGAGTTTTTTTTTTTTTTTTGGAATTGCAGTGACTG
 
. : . : . : . : . : . :
rJMFF049L23- TAAATCGTCATCATTATTGAGTAAAAGAATGTCATGACTTTTTTGTTACAATGCTTGGAA
JMFF049L23+ TAAATCGTCATCATTATTGAGTAAAAGAATGTCATGACTTTTTTGTTACAATGCTTGGAA
JMFS029F11+ TAAATCGTCATCATTATTGAGTAAAAGAATGTCATGACTTTTTTGTTACAATGCTTGGAA
                      ____________________________________________________________
consensus TAAATCGTCATCATTATTGAGTAAAAGAATGTCATGACTTTTTTGTTACAATGCTTGGAA
 
. : . : . : . : . : . :
rJMFF049L23- GCACAGACCAAAACCACAAAGCAAAACACAAGAGATGGACATTATAGGTGTTTGCCCACA
JMFF049L23+ GCACAGACCAAAACCACAAAGCAAAACACAAGAGATGGACATTATAGGTGTTTGCCCACA
JMFS029F11+ GCACAGACCAAAACCACAAAGCAAAACACAAGAGATGGACATTATAGGTGTTTGCCCACA
                      ____________________________________________________________
consensus GCACAGACCAAAACCACAAAGCAAAACACAAGAGATGGACATTATAGGTGTTTGCCCACA
 
. : . : . : . : . : . :
rJMFF049L23- ATTTCAGCAACCAAGAATAGTGGAGAACTTTTTATTTCTAAACACCCCGTTTGTAAAGCT
JMFF049L23+ ATTTCAGCAACCAAGAATAGTGGAGAACTTTTTATTTCTAAACACCCCGTTTGTAAAGCT
JMFS029F11+ ATTTCAGCAACCAAGAATAGTGGAGAACTTTTTATTTCTAAACACCCCGTTTGTAAAGCT
                      ____________________________________________________________
consensus ATTTCAGCAACCAAGAATAGTGGAGAACTTTTTATTTCTAAACACCCCGTTTGTAAAGCT
 
. : . : . : . : . : . :
rJMFF049L23- ACCAGAGAGAAGACGGAAGCTAATCGGAGGAAGGAGCAGAGAGCATCTCCACGAGCTTCT
JMFF049L23+ ACCAGAGAGAAGACGGAAGCTAATCGGAGGAAGGAGCAGAGAGCATCTCCACGAGCTTCT
JMFS029F11+ ACCAGAGAGAAGACGGAAGCTAATCGGAGGAAGGAGCAGAGAGCATCTCCACGAGCTTCT
                      ____________________________________________________________
consensus ACCAGAGAGAAGACGGAAGCTAATCGGAGGAAGGAGCAGAGAGCATCTCCACGAGCTTCT
 
. : . : . : . : . : . :
rJMFF049L23- TGTCCCGCCTTTCCATCGCTACATCCCACACGTCATTCCCGATGTGCTTAGGCCGGCCAT
JMFF049L23+ TGTCCCGCCTTTCCATCGCTACATCCCACACGTCATTCCCGATGTGCTTAGGCCGGCCAT
JMFS029F11+ TGTCCCGCCTTTCCATCGCTACATCCCACACGTCATTCCCGATGTGCTTAGGCCGGCCAT
                      ____________________________________________________________
consensus TGTCCCGCCTTTCCATCGCTACATCCCACACGTCATTCCCGATGTGCTTAGGCCGGCCAT
 
. : . : . : . : . : . :
rJMFF049L23- GGTAGGCTTTGTGGACAAAGTATTGGATATTGCCGGCAACGCAAAGCATACCGGCGATAA
JMFF049L23+ GGTAGGCTTTGTGGACAAAGTATTGGATATTGCCGGCAACGCAAAGCATACCGGCGATAA
JMFS029F11+ GGTAGGCTTTGTGGACAAAGTATTGGATATTGCCGGCAACGCAAAGCATACCGGCGATAA
                      ____________________________________________________________
consensus GGTAGGCTTTGTGGACAAAGTATTGGATATTGCCGGCAACGCAAAGCATACCGGCGATAA
 
. : . : . : . : . : . :
rJMFF049L23- TTCCCAACGGCAG
JMFF049L23+ TTCCCAACGGCAG
JMFS029F11+ TTCCCAACGGCAGCGCCGCCTCCAACCAAACAAGCGCCATTTCCTCAGCCTTCGGTTTCC
                      ____________________________________________________________
consensus TTCCCAACGGCAGCGCCGCCTCCAACCAAACAAGCGCCATTTCCTCAGCCTTCGGTTTCC
 
. : . : . : . : . : . :
JMFS029F11+ CCCCTCGAGTTTTCCAGTACCAGTTCGAAAACGCACAGCAAATCAGCAGAGACGAATTGA
                      ____________________________________________________________
consensus CCCCTCGAGTTTTCCAGTACCAGTTCGAAAACGCACAGCAAATCAGCAGAGACGAATTGA