Previous Contig 003096:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022A01Sequence383003096 (2)pir|F96806|F968069e-20probable AUX1-like permease, 10674-8589 [imported] - Arabidopsis thaliana>gb:AE0734010216 (3)gb:AY115842_15789326e-68Medicago truncatula auxin influx carrier protein (LAX3) gene, complete cds.>gb:M
JMFS029F09Sequence556003096 (2)gb:AY115842_15789323e-47Medicago truncatula auxin influx carrier protein (LAX3) gene, complete cds.>gb:M

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS029F09+ CAGTAGCCCATCGAGAA
                      ____________________________________________________________
consensus CAGTAGCCCATCGAGAA
 
. : . : . : . : . : . :
JMFS029F09+ CTTCAAACCACTGAATGACATGGTGTCTANAGACAACTTTCTCTCTTTCCTTTATGGTTC
                      ____________________________________________________________
consensus CTTCAAACCACTGAATGACATGGTGTCTANAGACAACTTTCTCTCTTTCCTTTATGGTTC
 
. : . : . : . : . : . :
JMFS029F09+ TGTACTCCACATAAAGCACACTTATGAGATAAGCAGTCCAGCTCCCCATGAGCCCATAGA
                      ____________________________________________________________
consensus TGTACTCCACATAAAGCACACTTATGAGATAAGCAGTCCAGCTCCCCATGAGCCCATAGA
 
. : . : . : . : . : . :
JMFF022A01+ GAATATAATTCCAGACACCATTCCCAGTTGCGAAAATGAGTATGGCAGTGTCA
JMFS029F09+ AGAGCTGGAATATAATTCCAGACACCATTCCCAGTTGCGAAAATGAGTATGGCAGTGTCA
                      ____________________________________________________________
consensus AGAGCTGGAATATAATTCCAGACACCATTCCCAGTTGCGAAAATGAGTATGGCAGTGTCA
 
. : . : . : . : . : . :
JMFF022A01+ GCAGAACTTGTGCAACCCTGATTAGAAGCACAACTAAACCATGCATCATACACAGAGCCG
JMFS029F09+ GCAGAACTTGTGCCA-CCTGATTAGAAGCACATGTAAACCATGCATCATACACAGAGCCG
                      ____________________________________________________________
consensus GCAGAACTTGTGCCACCCTGATTAGAAGCACATGTAAACCATGCATCATACACAGAGCCG
 
. : . : . : . : . : . :
JMFF022A01+ CCATGCCAGAAAAGCTTGGAGAATTTGGTCTTAAAAGACTTATTATTATTATTATTATCA
JMFS029F09+ CCATGCCAGAAAAGCTTGGAGAATTTGGTCTTAAAAGACTTATTATTATTATTATTATCA
                      ____________________________________________________________
consensus CCATGCCAGAAAAGCTTGGAGAATTTGGTCTTAAAAGACTTATTATTATTATTATTATCA
 
. : . : . : . : . : . :
JMFF022A01+ GAAC-TGCAGGCTTCTTCGTGTTCCATCTCTACGTAGTTCCCGGCTATCACCGTTTCCAC
JMFS029F09+ GAGCGTGCAGGCTTCTTCGTGTTCCATCTCTACGTAGTTCCCGGCTATCACCGTTTCCAC
                      ____________________________________________________________
consensus GAGCGTGCAGGCTTCTTCGTGTTCCATCTCTACGTAGTTCCCGGCTATCACCGTTTCCAC
 
. : . : . : . : . : . :
JMFF022A01+ CTTCTCTGAAGCCATCATATATTATATATATATTTGATGAGACCGGAGGGGTGTGAATTG
JMFS029F09+ CTTCTCTGAAGCCATCATATATTATATATATATTTGATGAGACCGGAGGGGTGTGAATTG
                      ____________________________________________________________
consensus CTTCTCTGAAGCCATCATATATTATATATATATTTGATGAGACCGGAGGGGTGTGAATTG
 
. : . : . : . : . : . :
JMFF022A01+ AAGACTAGCTTCAAGTACCTACAGTGATATATAT
JMFS029F09+ AAGACTAGCTTCAAGTACCTACAGTGATATATATATATATATATATATATATATATATAT
                      ____________________________________________________________
consensus AAGACTAGCTTCAAGTACCTACAGTGATATATATATATATATATATATATATATATATAT
 
. : . : . : . : . : . :
JMFS029F09+ ATATATATATATATATATATATATATATATATATGATGAACAACCAACTTCCAATTCAAT
                      ____________________________________________________________
consensus ATATATATATATATATATATATATATATATATATGATGAACAACCAACTTCCAATTCAAT