Previous Contig 003095:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS029F08Sequence602003095 (2)
JMFS031D05Sequence478003095 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS029F08+ AT
                      ____________________________________________________________
consensus AT
 
. : . : . : . : . : . :
JMFS031D05+ GAGCTCCCTATAAATTT
JMFS029F08+ CCCAATCTCCCCGGGTTTGCTTCTCCCCCTTGCTGGCATCTCTGAGCTCCCTATAAATTT
                      ____________________________________________________________
consensus CCCAATCTCCCCGGGTTTGCTTCTCCCCCTTGCTGGCATCTCTGAGCTCCCTATAAATTT
 
. : . : . : . : . : . :
JMFS031D05+ CCACTGGATCAC-GGCCCGCTATATGAGCAAAATCCAATCTTTTCTCACACCCAACCTTC
JMFS029F08+ CCACTGGATCACGGGCCCGCTATATGAGCAAAATCCAATCTTTTCTCACACCCAACCTTC
                      ____________________________________________________________
consensus CCACTGGATCACGGGCCCGCTATATGAGCAAAATCCAATCTTTTCTCACACCCAACCTTC
 
. : . : . : . : . : . :
JMFS031D05+ CCATCTTCATTCTCCTCCTTCCCCAACTCCAGATTACCAGCTTCACCCTCCACGTTTTCC
JMFS029F08+ CCATCTTCATTCTCCTCCTTCCCCAACTCCAGATTACCAGCTTCACCCTCCACGTTTTCC
                      ____________________________________________________________
consensus CCATCTTCATTCTCCTCCTTCCCCAACTCCAGATTACCAGCTTCACCCTCCACGTTTTCC
 
. : . : . : . : . : . :
JMFS031D05+ ACTGGACTCGAACAAGAACCATCATTTCCACCCAGCGCAGAAAAATGGCGTCCACTGAAA
JMFS029F08+ ACTGGACTCGAACAAGAACCATCATTTCCACCCAGCGCAGAAAAATGGCGTCCACTGAAA
                      ____________________________________________________________
consensus ACTGGACTCGAACAAGAACCATCATTTCCACCCAGCGCAGAAAAATGGCGTCCACTGAAA
 
. : . : . : . : . : . :
JMFS031D05+ CTTAAAAATCCAAACTTTGTGAATTGCGCGAAGTGGGTGTGCAAGAACTGAGGCTGGGGT
JMFS029F08+ CTTAAAAATCCAAACTTTGTGAATTGCGCGAAGTGGGTGTGCAAGAACTGAGGCTGGGGT
                      ____________________________________________________________
consensus CTTAAAAATCCAAACTTTGTGAATTGCGCGAAGTGGGTGTGCAAGAACTGAGGCTGGGGT
 
. : . : . : . : . : . :
JMFS031D05+ GGTAATCTGGGCTCATGGAAGGGGTAATCTTGAAATTTCCTGGATTCTGGAGTGCGGGCA
JMFS029F08+ GGTAATCTGGGCTCATGGAAGGGGTAATCTTGAAATTTCCTGGATTCTGGAGTGCGGGCA
                      ____________________________________________________________
consensus GGTAATCTGGGCTCATGGAAGGGGTAATCTTGAAATTTCCTGGATTCTGGAGTGCGGGCA
 
. : . : . : . : . : . :
JMFS031D05+ TGGAGGAAACGGTTTGAGCAGGGAAAAAGTGTGGCCCTAAAGAAGTTTCTCTTGGAAGAG
JMFS029F08+ TGGAGGAAACGGTTTGAGCAGGGAAAAAGTGTGGCCCTAAAGAAGTTTCTCTTGGAAGAG
                      ____________________________________________________________
consensus TGGAGGAAACGGTTTGAGCAGGGAAAAAGTGTGGCCCTAAAGAAGTTTCTCTTGGAAGAG
 
. : . : . : . : . : . :
JMFS031D05+ GAACAGAGATGGAGGAGGGGTCTTGCCATTGACGGAGAAATAGTATTGAACTAGAAATGC
JMFS029F08+ GAACAGAGATGGAGGAGGGGTCTTGCCATTGACGGAGAAATAGTATTGAACTAGAAATGC
                      ____________________________________________________________
consensus GAACAGAGATGGAGGAGGGGTCTTGCCATTGACGGAGAAATAGTATTGAACTAGAAATGC
 
. : . : . : . : . : . :
JMFS031D05+ AGTAATATGCATAGAAGCGAAATCATATGCAGGTATACAGGT
JMFS029F08+ AGTAATATGCATAGAAGCGAAATCATATGCAGGTATACAGGTGAAATTAAATGGGAAAGA
                      ____________________________________________________________
consensus AGTAATATGCATAGAAGCGAAATCATATGCAGGTATACAGGTGAAATTAAATGGGAAAGA
 
. : . : . : . : . : . :
JMFS029F08+ GAAGCATACCTGAGATTCTGAGAATGAGAAAGAGGGAAGAGAGAATGGAGGGAAAGGGAC
                      ____________________________________________________________
consensus GAAGCATACCTGAGATTCTGAGAATGAGAAAGAGGGAAGAGAGAATGGAGGGAAAGGGAC