Previous Contig 003089:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS028F08Sequence613003089 (4)pir|T49270|T492702e-07receptor protein kinase-like - Arabidopsis thaliana>gb:ATF12M12_1548403 Arabidop
JMFS047A01Sequence603003089 (4)pir|T49270|T492708e-32receptor protein kinase-like - Arabidopsis thaliana>gb:ATF12M12_1548403 Arabidop
JMFS093A09Sequence460003089 (4)
JMFS121A07Sequence570003089 (4)gb:AB006705_15100012e-47Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTH12.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS121A07+ ATCCCAAGATCTCCATAGTGTATCG
                      ____________________________________________________________
consensus ATCCCAAGATCTCCATAGTGTATCG
 
. : . : . : . : . : . :
JMFS121A07+ TTGTCGGGTGTCAAAGGCGATCCGCCCATGTTCACCCTAGCAACCGTCTCCAGTGCTTGT
                      ____________________________________________________________
consensus TTGTCGGGTGTCAAAGGCGATCCGCCCATGTTCACCCTAGCAACCGTCTCCAGTGCTTGT
 
. : . : . : . : . : . :
JMFS121A07+ CCAGACAGGCCATTGAACGTCCCGGCTGGGCTGATGGATGCAGCAGTATCAGCTATGAGC
                      ____________________________________________________________
consensus CCAGACAGGCCATTGAACGTCCCGGCTGGGCTGATGGATGCAGCAGTATCAGCTATGAGC
 
. : . : . : . : . : . :
JMFS121A07+ GTGTCGGGAACTGATACAACCTCCAACGCGTTTACATAAGCGAACGAATTATCTGAAGGG
                      ____________________________________________________________
consensus GTGTCGGGAACTGATACAACCTCCAACGCGTTTACATAAGCGAACGAATTATCTGAAGGG
 
. : . : . : . : . : . :
JMFS121A07+ CTGAAGGTTATCACAAGGTCCCCCGATGCTACATTCACCGAGAATTCCTTGGCAGTAACA
JMFS047A01+ TCACAAGGTCCCCCGATGCTACATTCACCGAGAATTCCTTGGCAGTAACA
                      ____________________________________________________________
consensus CTGAAGGTTATCACAAGGTCCCCCGATGCTACATTCACCGAGAATTCCTTGGCAGTAACA
 
. : . : . : . : . : . :
JMFS121A07+ TTTTGAGGGCTAAAATTGGCAAGGAGAACATGGTTTTGGGCGGAGACCGAGAAACTAGCT
JMFS047A01+ TTTTGAGGGCTAAAATTGGCAAGGAGAACATGGTTTTGGGCGGAGACCGAGAAACTAGCT
                      ____________________________________________________________
consensus TTTTGAGGGCTAAAATTGGCAAGGAGAACATGGTTTTGGGCGGAGACCGAGAAACTAGCT
 
. : . : . : . : . : . :
JMFS121A07+ GCCTTCATATTATAGTTCTGGAAAACAAACGGGTAGAAATAGAGGCGGATCCAGTGCCTC
JMFS047A01+ GCCTTCATATTATAGTTCTGGAAAACAAACGGGTAGAAATAGAGGCGGATCCAGTGCCTC
                      ____________________________________________________________
consensus GCCTTCATATTATAGTTCTGGAAAACAAACGGGTAGAAATAGAGGCGGATCCAGTGCCTC
 
. : . : . : . : . : . :
JMFS121A07+ CCACCCTGGCTAATCGAAAGCTTGTAGCTCGATTTTTCACTGAAAATTCTAGCTGTCTGA
JMFS047A01+ CCACCCTGGCTAATCGAAAGCTTGTAGCTCGATTTTTCACTGAAAATTCTAGCTGTCTGA
                      ____________________________________________________________
consensus CCACCCTGGCTAATCGAAAGCTTGTAGCTCGATTTTTCACTGAAAATTCTAGCTGTCTGA
 
. : . : . : . : . : . :
JMFS121A07+ TAAAGCAGAGAATCCTCTGAGGGTATAATGGAGTTAGAAGGGGCAACAGCCAATATGTCT
JMFS047A01+ TAAAGCAGAGAATCCTCTGAGGGTATAATGGAGTTAGAAGGGGCAACAGCCAATATGTCT
JMFS028F08+ AGCCAATATGTCT
                      ____________________________________________________________
consensus TAAAGCAGAGAATCCTCTGAGGGTATAATGGAGTTAGAAGGGGCAACAGCCAATATGTCT
 
. : . : . : . : . : . :
JMFS121A07+ TGTGAAGTTGAAAGGAATTTTGAGGCTGATTTATCAGACACAAAAACCCTGCCACTCACT
JMFS047A01+ TGTGAAGTTGAAAGGAATTTTGAGGCTGATTTATCAGACACAAAAACCCTGCCACTCACT
JMFS028F08+ TGTGAAGTTGAAAGGAATTTTGAGGCTGATTTATCAGACACAAAAACCCTGCCACTCACT
                      ____________________________________________________________
consensus TGTGAAGTTGAAAGGAATTTTGAGGCTGATTTATCAGACACAAAAACCCTGCCACTCACT
 
. : . : . : . : . : . :
JMFS121A07+ TTGCC
JMFS047A01+ TTGCCATCATTAGGTGATCCACAGTTTATCAAGTATTTATCTCCAGGATCAAAGCTAGAA
JMFS028F08+ TTGCCATCATTAGGTGATCCACAGTTTATCAAGTATTTATCTCCAGGATCAAAGCTAGAA
                      ____________________________________________________________
consensus TTGCCATCATTAGGTGATCCACAGTTTATCAAGTATTTATCTCCAGGATCAAAGCTAGAA
 
. : . : . : . : . : . :
JMFS047A01+ CCAAAACCCCCCAAGAACACTATGAGCAGAGCCCAGATTACTAATCCAAAACCCCAATAC
JMFS093A09+ CAAGAGCACTATGAGCAGAGCCCGGATTACTAATCCAAAACCCCAATAC
JMFS028F08+ CCAAAACCCCCCAAGAACACTATGAGCAGAGCCCAGATTACTAATCCAAAACCCCAATAC
                      ____________________________________________________________
consensus CCAAAACCCCCCAAGAACACTATGAGCAGAGCCCAGATTACTAATCCAAAACCCCAATAC
 
. : . : . : . : . : . :
JMFS047A01+ ATAATCAAACACACAAAAAAGCAAAGAATCTTAAATTATAAGCCTAAGATCTATGAAACT
JMFS093A09+ ATAATCAAACACACAAAAAAGCAAAGAATCTTAAATTATAAGCCTAAGATCTATGAAACT
JMFS028F08+ ATAATCAAACACACAAAAAAGCAAAGAATCTTAAATTATAAGCCTAAGATCTATGAAACT
                      ____________________________________________________________
consensus ATAATCAAACACACAAAAAAGCAAAGAATCTTAAATTATAAGCCTAAGATCTATGAAACT
 
. : . : . : . : . : . :
JMFS047A01+ GAGATGACACTCAGCGTTTCAACACAATGCTTACCAAAATCTGGAAATACCCAATAAAGA
JMFS093A09+ GAGATGACACTCAGCGTTTCAACACAATGCTTACCAAAATCTGGAAATACCCAATAAAGA
JMFS028F08+ GAGATGACACTCAGCGTTTCAACACAATGCTTACCAAAATCTGGAAATACCCAATAAAGA
                      ____________________________________________________________
consensus GAGATGACACTCAGCGTTTCAACACAATGCTTACCAAAATCTGGAAATACCCAATAAAGA
 
. : . : . : . : . : . :
JMFS047A01+ AAACAGAAGAAAA
JMFS093A09+ AAACAGAAGAAAATGGGGAAAGATGGCACCTTTGCAATCAACTGAGAAGAAACAAAACAG
JMFS028F08+ AAACAGAAGAAAATGGGGAAAGATGGCACCTTTGCAATCAACTGAGAAGAAACAAAACAG
                      ____________________________________________________________
consensus AAACAGAAGAAAATGGGGAAAGATGGCACCTTTGCAATCAACTGAGAAGAAACAAAACAG
 
. : . : . : . : . : . :
JMFS093A09+ AGCCGGGTAATCGGGTCGGGAAATTTAGTATAGAGCCAAAACACGGGAATATGACTATAT
JMFS028F08+ AGCCGGGTAATCGGGTCGGGAAATTTAGTATAGAGCCAAAACACGGGAATATGACTATAT
                      ____________________________________________________________
consensus AGCCGGGTAATCGGGTCGGGAAATTTAGTATAGAGCCAAAACACGGGAATATGACTATAT
 
. : . : . : . : . : . :
JMFS093A09+ TCTTCGCCGCCTAAACAGCTGGAATCCAGTAAACCACTGGCAGGGGGGTTTAGAAGCTGA
JMFS028F08+ TCTTCGCCGCCTAAACAGCTGGAATCCAGTAAACCACTGGCAGGGGGGTTTAGAAGCTGA
                      ____________________________________________________________
consensus TCTTCGCCGCCTAAACAGCTGGAATCCAGTAAACCACTGGCAGGGGGGTTTAGAAGCTGA
 
. : . : . : . : . : . :
JMFS093A09+ GAAGGATCACCGCAAAAACAGACAAATGAGAGATTCCTAAGCACAAAATTCTTTCACTCA
JMFS028F08+ GAAGGATCACCGCAAAAACAGACAAATGAGAGATTCCTAAGCACAAAATTCTTTCACTCA
                      ____________________________________________________________
consensus GAAGGATCACCGCAAAAACAGACAAATGAGAGATTCCTAAGCACAAAATTCTTTCACTCA
 
. : . : . : . : . : . :
JMFS093A09+ CAGTTCATGTGGACATCGAGGGTTTCCGGATTAGGGTGACAAACGGAGAAA
JMFS028F08+ CAGTTCATGTGGACATCGAGGGTTTCCGGATTAGGGTGACAAACGGAGAAATGGGATGGG
                      ____________________________________________________________
consensus CAGTTCATGTGGACATCGAGGGTTTCCGGATTAGGGTGACAAACGGAGAAATGGGATGGG