Previous Contig 003085:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS028B01Sequence627003085 (2)
JMSF005G12Sequence254003085 (2)192008131 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF005G12+ CNTTAAGAGCCAGAAGTTGGGATTTTGAGGAAAGT
                      ____________________________________________________________
consensus CNTTAAGAGCCAGAAGTTGGGATTTTGAGGAAAGT
 
. : . : . : . : . : . :
JMSF005G12+ TGAAATCTTGGAAATGGGAAATCCAGAAAGACGAGATTTTTTTTTGATCAGCAGCAAAGA
JMFS028B01+ AGATTTTTTTTTGATCAGCAGCAAAGA
                      ____________________________________________________________
consensus TGAAATCTTGGAAATGGGAAATCCAGAAAGACGAGATTTTTTTTTGATCAGCAGCAAAGA
 
. : . : . : . : . : . :
JMSF005G12+ ATTATTGGCGGAATTCGAGCTCTTGGGGAAAGAGAAAGCAAGGGGAGAAGAAAAGAAGTT
JMFS028B01+ ATTATTGGCGGAATTCGAGCTCTTGGGGAAAGAGAAAGCAAGGGGAGAAGAAAAGAAGTT
                      ____________________________________________________________
consensus ATTATTGGCGGAATTCGAGCTCTTGGGGAAAGAGAAAGCAAGGGGAGAAGAAAAGAAGTT
 
. : . : . : . : . : . :
JMSF005G12+ GAATTGCCAAGAAAAAAGGGCACCACTTTCTGGTGAAATGATCAAATGCCAGAGAAACAA
JMFS028B01+ GAATTGCCAAGAAAAAAGGGCACCACTTTCTGGTGAAATGATCAAATGCCAGAGAAACAA
                      ____________________________________________________________
consensus GAATTGCCAAGAAAAAAGGGCACCACTTTCTGGTGAAATGATCAAATGCCAGAGAAACAA
 
. : . : . : . : . : . :
JMSF005G12+ ATCTCTATAAGGATTCAGGAATCAGGGAATTCAGCAG
JMFS028B01+ ATCTCTATAAGGATTCAGGAATCAGGGAATTCAGCAGAGTAGAATTTAAGCTCAACAATG
                      ____________________________________________________________
consensus ATCTCTATAAGGATTCAGGAATCAGGGAATTCAGCAGAGTAGAATTTAAGCTCAACAATG
 
. : . : . : . : . : . :
JMFS028B01+ GAAAGAGATAAAGGAAGAGTGGAAAGCAAAGATAATTCAACTATTCAAGAAAAGAGAACC
                      ____________________________________________________________
consensus GAAAGAGATAAAGGAAGAGTGGAAAGCAAAGATAATTCAACTATTCAAGAAAAGAGAACC
 
. : . : . : . : . : . :
JMFS028B01+ AAAATCAACAAAAGAAACTTAATTTAGTAATTTCCAAGAACTAAGGTCAAGAATGGGTCT
                      ____________________________________________________________
consensus AAAATCAACAAAAGAAACTTAATTTAGTAATTTCCAAGAACTAAGGTCAAGAATGGGTCT
 
. : . : . : . : . : . :
JMFS028B01+ GAAAAAAAAAAGAGAGAAAAAGTAAATAAAGATGCTAAGCATAGGCCGCAAGAAAAGAGA
                      ____________________________________________________________
consensus GAAAAAAAAAAGAGAGAAAAAGTAAATAAAGATGCTAAGCATAGGCCGCAAGAAAAGAGA
 
. : . : . : . : . : . :
JMFS028B01+ GGTGAAGAGGGGGGGAAAAGAAAAGAAGCCACAGTGCCACACCACCCTCCTTCCTTCCTT
                      ____________________________________________________________
consensus GGTGAAGAGGGGGGGAAAAGAAAAGAAGCCACAGTGCCACACCACCCTCCTTCCTTCCTT
 
. : . : . : . : . : . :
JMFS028B01+ CCTTCTCTACTTTTCCAAGCTTTTCATTATTATATATTTATTTAAATTTAAATTTTATTA
                      ____________________________________________________________
consensus CCTTCTCTACTTTTCCAAGCTTTTCATTATTATATATTTATTTAAATTTAAATTTTATTA
 
. : . : . : . : . : . :
JMFS028B01+ CAATTTTCATTTTTGGTTGTTTCTGCATAAAAACTATCATTTTTAGAGGTCCTATTATTA
                      ____________________________________________________________
consensus CAATTTTCATTTTTGGTTGTTTCTGCATAAAAACTATCATTTTTAGAGGTCCTATTATTA
 
. : . : . : . : . : . :
JMFS028B01+ ATTGTTATTAATAATTCTAGTGGGGTTTGAGGTTGGATCCTTCCAGGCTGTCCTAATTGA
                      ____________________________________________________________
consensus ATTGTTATTAATAATTCTAGTGGGGTTTGAGGTTGGATCCTTCCAGGCTGTCCTAATTGA