Previous Contig 003083:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007E18Sequence584003083 (7)gb:AY496109_11784491e-18Capsicum annuum induced stolon tip protein mRNA, complete cds.559003083 (7)gb:AY496109_11784496e-28Capsicum annuum induced stolon tip protein mRNA, complete cds.
JMFF035J10Sequence241003083 (7)
JMFN034A24Sequence572003083 (7)gb:AY496109_11784496e-28Capsicum annuum induced stolon tip protein mRNA, complete cds.
JMFN039F02Sequence543003083 (7)gb:AY496109_11784491e-25Capsicum annuum induced stolon tip protein mRNA, complete cds.
JMFS027H03Sequence520003083 (7)gb:AY496109_11784493e-17Capsicum annuum induced stolon tip protein mRNA, complete cds.
JMSF020M15Sequence587003083 (7)gb:AY496109_11784497e-28Capsicum annuum induced stolon tip protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007E18+ TTTTTTTTTTGGGTTTGATTC
JMSF020M15+ TTTTTTTTTTGGGTTTGATTC
                      ____________________________________________________________
consensus TTTTTTTTTTGGGTTTGATTC
 
. : . : . : . : . : . :
JMFF007E18+ CCGATTTCTTCACACCTTTAGAATCTTAGCAGCTCGGACCACCGGATTTTTCCCTCGCAA
JMSF020M15+ CCGATTTCTTCACACCTTTAGAATCTTAGCAGCTCGGACCACCGGA-TTTTCCCTCGCAA
rJMFF007E18- CGATTTCTTC-CACCTTTAGAATCTTAGCAGCTCGGACCACCGGA-TTTTCCCTCGCAA
JMFN034A24+ CGATTTCTTCACACCTTTAGAATCTTAGCAGCTCGGACCACCGGA-TTTTCCCTCGCAA
JMFN039F02+ TAGCAGCTCGGACCACCGGA-TTTTCCCTCGCAA
                      ____________________________________________________________
consensus CCGATTTCTTCACACCTTTAGAATCTTAGCAGCTCGGACCACCGGA-TTTTCCCTCGCAA
 
. : . : . : . : . : . :
JMFF007E18+ TCGCCTCGCGTCCGGCGGCTTTGTAATCGAAGGTGCAGTCGTGGCGATCCGAGTACCTGT
JMSF020M15+ TCGCCTCGCGTCCGGCGGCTTTGTAATCGAAGGTGCAGTCGTGGCGATCCGAGTACCTGT
rJMFF007E18- TCGCCTCGCGTCCGGCGGCTTTGTAATCGAAGGTGCAGTCGTGGCGATCCGAGTACCTGT
JMFN034A24+ TCGCCTCGCGTCCGGCGGCTTTGTAATCGAAGGTGCAGTCGTGGCGATCCGAGTACCTGT
JMFN039F02+ TCGCCTCGCGTCCGGCGGCTTTGTAATCGAAGGTGCAGTCGTGGCGATCCGAGTACCTGT
JMFS027H03+ TTTGTAATCGAAGGTGCAGTCGTGGCGATCCGAGTACCTGT
                      ____________________________________________________________
consensus TCGCCTCGCGTCCGGCGGCTTTGTAATCGAAGGTGCAGTCGTGGCGATCCGAGTACCTGT
 
. : . : . : . : . : . :
JMFF007E18+ GCTCGGAACAGAACACCTTCGCCGCACCGGCATCGGAAGCCGATCAGCCCGACTTTCCGT
JMSF020M15+ GCTCGGAACAGAACACC-TCGCCGCACCGGCATCGGAAGCCGATCAGCCCGACTTTCCGT
rJMFF007E18- GCTCGGAACAGAACACC-TCGCCGCACCGGCATCGGAAGCCGATCAGCCCGACTTTCCGT
JMFN034A24+ GCTCGGAACAGAACACC-TCGCCGCACCGGCATCGGAAGCCGATCAGCCCGACTTTCCGT
JMFN039F02+ GCTCGGAACAGAACACC-TCGCCGCACCGGCATCGGAAGCCGATCAGCCCGACTTTCCGT
JMFS027H03+ GCTCGGAACAGAACACC-TCGCCGCACCGGCATCGGAAGCCGATCAGCCCGACTTTCCGT
                      ____________________________________________________________
consensus GCTCGGAACAGAACACC-TCGCCGCACCGGCATCGGAAGCCGATCAGCCCGACTTTCCGT
 
. : . : . : . : . : . :
JMFF007E18+ CTGCACCCGTCCCCGGAGCACCGGTTGACTTCTCTCGGCCTCTTCAAGGGACGATTCACC
JMSF020M15+ CTGCACCCGTCCCCGGAGCACCGGTTGACTTCTCTCGGCCTCTTCAAGGGACGATTCACC
rJMFF007E18- CTGCACCCGTCCCCGGAGCACCGGTTGACTTCTCTCGGCCTCTTCAAGGGACGATTCACC
JMFN034A24+ CTGCACCCGTCCCCGGAGCACCGGTTGACTTCTCTCGGCCTCTTCAAGGGACGATTCACC
JMFN039F02+ CTGCACCCGTCCCCGGAGCACCGGTTGACTTCTCTCGGCCTCTTCAAGGGACGATTCACC
JMFS027H03+ CTGCACCCGTCCCCGGAGCACCGGTTGACTTCTCTCGGCCTCTTCAAGGGACGATTCACC
                      ____________________________________________________________
consensus CTGCACCCGTCCCCGGAGCACCGGTTGACTTCTCTCGGCCTCTTCAAGGGACGATTCACC
 
. : . : . : . : . : . :
JMFF007E18+ GCTTCCGCTTCCGCTTCCGGCCTCTTCGGAGGAGAAACGACCGGATCGGACCTCTCCGGC
JMSF020M15+ GCTTCCGCTTCCGCTTCCGGCCTCTTCGGAGGAGAAACGACCGGATCGGACCTCTCCGGC
rJMFF007E18- GCTTCCGCTTCCGCTTCCGGCCTCTTCGGAGGAGAAACGACCGGATCGGACCTCTCCGGC
JMFN034A24+ GCTTCCGCTTCCGCTTCCGGCCTCTTCGGAGGAGAAACGACCGGATCGGACCTCTCCGGC
JMFN039F02+ GCTTCCGCTTCCGCTTCCGGCCTCTTCGGAGGAGAAACGACCGGATCGGACCTCTCCGGC
JMFS027H03+ GCTTCCGCTTCCGCTTCCGGCCTCTTCGGAGGAGAAACGACCGGATCGGACCTCTCCGGC
                      ____________________________________________________________
consensus GCTTCCGCTTCCGCTTCCGGCCTCTTCGGAGGAGAAACGACCGGATCGGACCTCTCCGGC
 
. : . : . : . : . : . :
rJMFF035J10- CATCGGAATCCTTCGGATCTGATCTCGCG
JMFF007E18+ GACCTCGCGGCACCAGATCTCGAATCATCAGCATCGGAATCCTTCGGATCTGATCTCGCG
JMSF020M15+ GACCTCGCGGCACCAGATCTCGAATCATCAGCATCGGAATCCTTCGGATCTGATCTCGCG
rJMFF007E18- GACCTCGCGGCACCAGATCTCGAATCATCAGCATCGGAATCCTTCGGATCTGATCTCGCG
JMFN034A24+ GACCTCGCGGCACCAGATCTCGAATCATCAGCATCGGAATCCTTCGGATCTGATCTCGCG
JMFN039F02+ GACCTCGCGGCACCAGATCTCGAATCATCAGCATCGGAATCCTTCGGATCTGATCTCGCG
JMFS027H03+ GACCTCGCGGCACCAGATCTCGAATCATCAGCATCGGAATCCTTCGGATCTGATCTCGCG
                      ____________________________________________________________
consensus GACCTCGCGGCACCAGATCTCGAATCATCAGCATCGGAATCCTTCGGATCTGATCTCGCG
 
. : . : . : . : . : . :
rJMFF035J10- GAGCTACCGGCAGACGACGAAGCCGCCGCCTGCGCTTGATCATCGGCGCCTGAGAGCTGC
JMFF007E18+ GAGCTACCGGCAGACGACGAAGCCGCCGCCTGCGCTTGATCATCGGCGCCTGAGAGCTGC
JMSF020M15+ GAGCTACCGGCAGACGACGAAGCCGCCGCCTGCGCTTGATCATCGGCGCCTGAGAGCTGC
rJMFF007E18- GAGCTACCGGCAGACGACGAAGCCGCCGCCTGCGCTTGATCATCGGCGCCTGAGAGCTGC
JMFN034A24+ GAGCTACCGGCAGACGACGAAGCCGCCGCCTGCGCTTGATCATCGGCGCCTGAGAGCTGC
JMFN039F02+ GAGCTACCGGCAGACGACGAAGCCGCCGCCTGCGCTTGATCATCGGCGCCTGAGAGCTGC
JMFS027H03+ GAGCTACCGGCAGACGACGAAGCCGCCGCCTGCGCTTGATCATCGGCGCCTGAGAGCTGC
                      ____________________________________________________________
consensus GAGCTACCGGCAGACGACGAAGCCGCCGCCTGCGCTTGATCATCGGCGCCTGAGAGCTGC
 
. : . : . : . : . : . :
rJMFF035J10- GGAGACACCGGAATCGTGGGAACGCATACGGATATGGTCTTGGGAAGCTTGAGCTCGGTT
JMFF007E18+ GGAGACACCGGAATCGTGGGAACGCATACGGATATGGTCTTGGGAAGCTTGAGCTCGGTT
JMSF020M15+ GGAGACACCGGAATCGTGGGAACGCATACGGATATGGTCTTGGGAAGCTTGAGCTCGGTT
rJMFF007E18- GGAGACACCGGAATCGTGGGAACGCATACGGATATGGTCTTGGGAAGCTTGAGCTCGGTT
JMFN034A24+ GGAGACACCGGAATCGTGGGAACGCATACGGATATGGTCTTGGGAAGCTTGAGCTCGGTT
JMFN039F02+ GGAGACACCGGAATCGTGGGAACGCATACGGATATGGTCTTGGGAAGCTTGAGCTCGGTT
JMFS027H03+ GGAGACACCGGAATCGTGGGAACGCATACGGATATGGTCTTGGGAAGCTTGAGCTCGGTT
                      ____________________________________________________________
consensus GGAGACACCGGAATCGTGGGAACGCATACGGATATGGTCTTGGGAAGCTTGAGCTCGGTT
 
. : . : . : . : . : . :
rJMFF035J10- TCTTCTTTCTCCCGTTGATGAGCCATGGATTGTAGAGAGAGAAAGCTGTAAAGGAGAATT
JMFF007E18+ TCTTCTTTCTCCCGTTGATGAGCCATGGATTGTAGAGAGAGAAAGCTGTAAAGGAGAATT
JMSF020M15+ TCTTCTTTCTCCCGTTGATGAGCCATGGATTGTAGAGAGAGAAAGCTGTAAAGGAGAATT
rJMFF007E18- TCTTCTTTCTCCCGTTGATGAGCCATGGATTGTAGAGAGAGAAAGCTGTAAAGGAGAATT
JMFN034A24+ TCTTCTTTCTCCCGTTGATGAGCCATGGATTGTAGAGAGAGAAAGCTGTAAAGGAGAATT
JMFN039F02+ TCTTCTTTCTCCCGTTGATGAGCCATGGATTGTAGAGAGAGAAAGCTGTAAAGGAGAATT
JMFS027H03+ TCTTCTTTCTCCCGTTGATGAGCCATGGATTGTAGAGAGAGAAAGCTGTAAAGGAGAATT
                      ____________________________________________________________
consensus TCTTCTTTCTCCCGTTGATGAGCCATGGATTGTAGAGAGAGAAAGCTGTAAAGGAGAATT
 
. : . : . : . : . : . :
rJMFF035J10- CTAGAGAGATAGAGGGGAAGGGC
JMFF007E18+ CTAGAGAGATAGAGGGGAAGGGC
JMSF020M15+ CTAGAGAGATAGAGGGGAAGGGCGTG
rJMFF007E18- CTAGAGAGATAGAGGGGAAGGGC
JMFN034A24+ CTAGAGAGATAGAGGGGAAGGGCGTG
JMFN039F02+ CTAGAGAGATAGAGGGGAAGGGCGTG
JMFS027H03+ CTAGAGAGATAGAGGGGAAGGGCGTGTTTGGTTGTCTCGAGCGAGAGAGAGGAAAATAGA
                      ____________________________________________________________
consensus CTAGAGAGATAGAGGGGAAGGGCGTGTTTGGTTGTCTCGAGCGAGAGAGAGGAAAATAGA