Previous Contig 003073:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS027D01Sequence620003073 (2)sp|Q43187|IPYR_SOLTU3e-04Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase
JMFS027G02Sequence553003073 (2)sp|Q43187|IPYR_SOLTU4e-04Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS027G02+ TAAACAATTTGTGATATTTTTACCTTG
JMFS027D01+ ACCTTG
                      ____________________________________________________________
consensus TAAACAATTTGTGATATTTTTACCTTG
 
. : . : . : . : . : . :
JMFS027G02+ ATAAGTCCAGTCTTCTTATCCAATTCATACTTCACCTTACCCCCCTTGCTGATCTCAATT
JMFS027D01+ ATAAGTCCAGTCTTCTTATCCAATTCATACTTCACCTTACCCCCCTTGCTGATCTCAATT
                      ____________________________________________________________
consensus ATAAGTCCAGTCTTCTTATCCAATTCATACTTCACCTTACCCCCCTTGCTGATCTCAATT
 
. : . : . : . : . : . :
JMFS027G02+ ACCTGCATAGATATAGAAAAACTAAACCTGAAATCCTTGTCCACACAAAAATAAACCTGA
JMFS027D01+ ACCTGCATAGATATAGAAAAACTAAACCTGAAATCCTTGTCCACACAAAAATAAACCTGA
                      ____________________________________________________________
consensus ACCTGCATAGATATAGAAAAACTAAACCTGAAATCCTTGTCCACACAAAAATAAACCTGA
 
. : . : . : . : . : . :
JMFS027G02+ TACCAAATTAATCCATTAAATATCATGCTATTCCCCGAGTATAACACAAGTAAATCCATA
JMFS027D01+ TACCAAATTAATCCATTAAATATCATGCTATTCCCCGAGTATAACACAAGTAAATCCATA
                      ____________________________________________________________
consensus TACCAAATTAATCCATTAAATATCATGCTATTCCCCGAGTATAACACAAGTAAATCCATA
 
. : . : . : . : . : . :
JMFS027G02+ TGGTCAAGGTCAATGAACACTTGAGCATTCAAATGGGAGGGATGGAGGGTAAGACAATAT
JMFS027D01+ TGGTCAAGGTCAATGAACACTTGAGCATTCAAATGGGAGGGATGGAGGGTAAGACAATAT
                      ____________________________________________________________
consensus TGGTCAAGGTCAATGAACACTTGAGCATTCAAATGGGAGGGATGGAGGGTAAGACAATAT
 
. : . : . : . : . : . :
JMFS027G02+ CAACATTTTTTTTTCCAAATTTCTGATGGATTTTCTTGAGGGTTCAAATAGGATTAGCTC
JMFS027D01+ CAACATTTTTTTTTCCAAATTTCTGATGGATTTTCTTGAGGGTTCAAATAGGATTAGCTC
                      ____________________________________________________________
consensus CAACATTTTTTTTTCCAAATTTCTGATGGATTTTCTTGAGGGTTCAAATAGGATTAGCTC
 
. : . : . : . : . : . :
JMFS027G02+ ATTTGGTTGTTGCATATAAATGGTTATAAGACGTATATGTTTTTTTACATTAAATGAAAA
JMFS027D01+ ATTTGGTTGTTGCATATAAATGGTTATAAGACGTATATGTTTTTTTACATTAAATGAAAA
                      ____________________________________________________________
consensus ATTTGGTTGTTGCATATAAATGGTTATAAGACGTATATGTTTTTTTACATTAAATGAAAA
 
. : . : . : . : . : . :
JMFS027G02+ AATTTAACGGAGTTCAAAGCAGTGGGATATGATTTACCGCATAATAAGAGTCCTAACTAA
JMFS027D01+ AATTTAACGGAGTTCAAAGCAGTGGGATATGATTTACCGCATAATAAGAGTCCTAACTAA
                      ____________________________________________________________
consensus AATTTAACGGAGTTCAAAGCAGTGGGATATGATTTACCGCATAATAAGAGTCCTAACTAA
 
. : . : . : . : . : . :
JMFS027G02+ ATTTCTAAAATGAACAAATTGAAAATTCAGAAGGAACATTGTAAAAGTTAAGTAATCTGA
JMFS027D01+ ATTTCTAAAATGAACAAATTGAAAATTCAGAAGGAACATTGTAAAAGTTAAGTAATCTGA
                      ____________________________________________________________
consensus ATTTCTAAAATGAACAAATTGAAAATTCAGAAGGAACATTGTAAAAGTTAAGTAATCTGA
 
. : . : . : . : . : . :
JMFS027G02+ AAGATTTGAGCAAAGTGAATGCTTACCACATT-AAAACCTTTGGAGC
JMFS027D01+ AAGATTTGAGCAAAGTGAATGCTTACCACATTGAAAACCTTTGGAGCTTCAGGCCCTGGA
                      ____________________________________________________________
consensus AAGATTTGAGCAAAGTGAATGCTTACCACATTGAAAACCTTTGGAGCTTCAGGCCCTGGA