Previous Contig 003071:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS018F11Sequence607003071 (18)gb:OSJN00007_16931686e-25Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000114_01, complete sequenc
JMFS025E09Sequence623003071 (18)pir|D86363|D863631e-42hypothetical protein F19G10.11 - Arabidopsis thaliana>gb:AE005172_891245 Arabido
JMFS027C03Sequence532003071 (18)pir|G85092|G850927e-09hypothetical protein AT4g09150 [imported] - Arabidopsis thaliana>gb:ATCHRIV26_15
JMFS053B12Sequence617003071 (18)pir|D86363|D863632e-52hypothetical protein F19G10.11 - Arabidopsis thaliana>gb:AE005172_891245 Arabido
JMFS057D08Sequence618003071 (18)gb:OSJN00007_16931685e-66Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000114_01, complete sequenc
JMFS072H12Sequence627003071 (18)pir|D86363|D863635e-57hypothetical protein F19G10.11 - Arabidopsis thaliana>gb:AE005172_891245 Arabido
JMFS086C10Sequence587003071 (18)gb:OSJN00007_16931683e-59Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000114_01, complete sequenc
JMFS095G04Sequence603003071 (18)gb:OSJN00007_16931682e-26Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000114_01, complete sequenc
JMFS106F08Sequence622003071 (18)gb:OSJN00007_16931688e-41Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000114_01, complete sequenc
JMFS119D07Sequence627003071 (18)pir|D86363|D863634e-60hypothetical protein F19G10.11 - Arabidopsis thaliana>gb:AE005172_891245 Arabido
JMFS127E07Sequence623003071 (18)pir|D86363|D863639e-61hypothetical protein F19G10.11 - Arabidopsis thaliana>gb:AE005172_891245 Arabido
JMFS130G09Sequence615003071 (18)pir|D86363|D863636e-61hypothetical protein F19G10.11 - Arabidopsis thaliana>gb:AE005172_891245 Arabido
JMFS141F02Sequence619003071 (18)gb:OSJN00007_16931686e-27Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000114_01, complete sequenc
JMFS156D11Sequence225003071 (18)gb:AX882216_14788376e-05Sequence 17121 from Patent EP1074617.>gb:AK022609_1909195 Homo sapiens cDNA FLJ1
JMFS158F08Sequence364003071 (18)pir|D86363|D863639e-31hypothetical protein F19G10.11 - Arabidopsis thaliana>gb:AE005172_891245 Arabido
JMFS160D02Sequence344003071 (18)gb:HHV6AGNM_24101270.003Human herpesvirus-6 (HHV-6) U1102, variant A DNA, complete virion genome.
JMFS160D03Sequence305003071 (18)gb:HHV6AGNM_24101270.004Human herpesvirus-6 (HHV-6) U1102, variant A DNA, complete virion genome.
JMFS161G05Sequence596003071 (18)pir|D86363|D863634e-46hypothetical protein F19G10.11 - Arabidopsis thaliana>gb:AE005172_891245 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS057D08+ CCAACAGAAGATGAGG
                      ____________________________________________________________
consensus CCAACAGAAGATGAGG
 
. : . : . : . : . : . :
JMFS057D08+ GACTCTGAGAAGCAGGGCATCCATTTTCTCTAGACTGGAAATACTTGTCACGTGTATCAG
                      ____________________________________________________________
consensus GACTCTGAGAAGCAGGGCATCCATTTTCTCTAGACTGGAAATACTTGTCACGTGTATCAG
 
. : . : . : . : . : . :
JMFS057D08+ AGAGTGCATTTTCCATGCGCTCTATACCAGCATCTCCACTTAGGTGATGCACTTTCTCCC
JMFS086C10+ GCATTTTCCATGCGCTCTATACCAGCATCTCCACTTAGGTGATGCACTTTCTCCC
                      ____________________________________________________________
consensus AGAGTGCATTTTCCATGCGCTCTATACCAGCATCTCCACTTAGGTGATGCACTTTCTCCC
 
. : . : . : . : . : . :
JMFS057D08+ TTAAAAGTCTCTGGTCTGCAGTAACCTGTTTCTGGACAGCCTTCATATCATGAGTAAGAG
JMFS086C10+ TTAAAAGTCTCTGGTCTGCAGTAACCTGTTTCTGGACAGCCTTCATATCATGAGTAAGAG
                      ____________________________________________________________
consensus TTAAAAGTCTCTGGTCTGCAGTAACCTGTTTCTGGACAGCCTTCATATCATGAGTAAGAG
 
. : . : . : . : . : . :
JMFS057D08+ GACCACTATCACCTTTAGGTGTCATCTTGCATGTCTGAATCATAGAGATTTCAAGCTGGC
JMFS086C10+ GACCACTATCACCTTTAGGTGTCATCTTGCATGTCTGAATCATAGAGATTTCAAGCTGGC
                      ____________________________________________________________
consensus GACCACTATCACCTTTAGGTGTCATCTTGCATGTCTGAATCATAGAGATTTCAAGCTGGC
 
. : . : . : . : . : . :
JMFS057D08+ ATGCAGCTCTCACCAAATCTTTCTCCAACGATTGAGCATCTTTAACCTTCCACACCACAA
JMFS086C10+ ATGCAGCTCTCACCAAATCTTTCTCCAACGATTGAGCATCTTTAACCTTCCACACCACAA
                      ____________________________________________________________
consensus ATGCAGCTCTCACCAAATCTTTCTCCAACGATTGAGCATCTTTAACCTTCCACACCACAA
 
. : . : . : . : . : . :
JMFS057D08+ AACTATTCAAATAAGAGCACCATGCTGAATCATAAGCTGCAAGCTGTGACCTGAAAGTTT
JMFS086C10+ AACTATTCAAATAAGAGCACCATGCTGAATCATAAGCTGCAAGCTGTGACCTGAAAGTTT
                      ____________________________________________________________
consensus AACTATTCAAATAAGAGCACCATGCTGAATCATAAGCTGCAAGCTGTGACCTGAAAGTTT
 
. : . : . : . : . : . :
JMFS057D08+ TACGTTCTACTGTAGAATTATCTGAAGTCAGTGTTGGCCCATTTAATATTATTCTAATCA
JMFS086C10+ TACGTTCTACTGTAGAATTATCTGAAGTCAGTGTTGGCCCATTTAATATTATTCTAATCA
                      ____________________________________________________________
consensus TACGTTCTACTGTAGAATTATCTGAAGTCAGTGTTGGCCCATTTAATATTATTCTAATCA
 
. : . : . : . : . : . :
JMFS057D08+ ACAGTTCAAACTCTTGGACAAATTTCTCTGCAGATGTTGCTAGAGCAACCTCACGTTCGC
JMFS086C10+ ACAGTTCAAACTCTTGGACAAATTTCTCTGCAGATGTTGCTAGAGCAACCTCACGTTCGC
                      ____________________________________________________________
consensus ACAGTTCAAACTCTTGGACAAATTTCTCTGCAGATGTTGCTAGAGCAACCTCACGTTCGC
 
. : . : . : . : . : . :
JMFS057D08+ CTTGACCACTGAGCACTGCATCGGGATGACCTAGTATCATATAAGCACAGAGCACAACTC
JMFS086C10+ CTTGACCACTGAGCACTGCATCGGGATGACCTAGTATCATATAAGCACAGAGCACAACTC
JMFS161G05+ TGCATCGGGATGACCTAGTATCATATAAGCACAGAGCACAACTC
                      ____________________________________________________________
consensus CTTGACCACTGAGCACTGCATCGGGATGACCTAGTATCATATAAGCACAGAGCACAACTC
 
. : . : . : . : . : . :
JMFS057D08+ GAACCTGGTACCGTGACAACTTAACAGGGGATCTTACAGCAGGTTTGCAAGAACCTGCTT
JMFS086C10+ GAACCTGGTACCGTGACAACTTAACAGGGGATCTTACAGCAGGTTTGCAAGAACCTGCTT
JMFS161G05+ GAACCTGGTACCGTGACAACTTAACAGGGGATCTTACAGCAGGTTTGCAAGAACCTGCTT
JMFS025E09+ TGACAACTTAACAGGGGATCTTACAGCAGGTTTGCAAGAACCTGCTT
                      ____________________________________________________________
consensus GAACCTGGTACCGTGACAACTTAACAGGGGATCTTACAGCAGGTTTGCAAGAACCTGCTT
 
. : . : . : . : . : . :
JMFS057D08+ TC
JMFS086C10+ TCTTTGCATCCCCATTGGAGATAGATCTCCTTGGTCTAGCCATTCTTTT
JMFS161G05+ TCTTTGCATCCCCATTGGAGATAGATCTCCTTGGTCTAGCCATTCTTTTAGGGGAAGCAA
JMFS025E09+ TCTTTGCATCCCCATTGGAGATAGATCTCCTTGGTCTAGCCATTCTTTTAGGGGAAGCAA
                      ____________________________________________________________
consensus TCTTTGCATCCCCATTGGAGATAGATCTCCTTGGTCTAGCCATTCTTTTAGGGGAAGCAA
 
. : . : . : . : . : . :
JMFS161G05+ CACGCTTAAGAAGGTGATCGATATCATCCCAACTAGAGGCATTAGAAGCACTGGTAAACT
JMFS025E09+ CACGCTTAAGAAGGTGATCGATATCATCCCAACTAGAGGCATTAGAAGCACTGGTAAACT
                      ____________________________________________________________
consensus CACGCTTAAGAAGGTGATCGATATCATCCCAACTAGAGGCATTAGAAGCACTGGTAAACT
 
. : . : . : . : . : . :
JMFS161G05+ CACGTGACAACTTGTAACGGAATTCAAGTCTATCAAGCAAGGCCTTTGTAGTCCGAAGAG
JMFS025E09+ CACGTGACAACTTGTAACGGAATTCAAGTCTATCAAGCAAGGCCTTTGTAGTCCGAAGAG
                      ____________________________________________________________
consensus CACGTGACAACTTGTAACGGAATTCAAGTCTATCAAGCAAGGCCTTTGTAGTCCGAAGAG
 
. : . : . : . : . : . :
JMFS161G05+ CATAACTAGATTCAATGAGAAGTGCAAGCTGCTCAAATGGCATCATCTTCACTGAGCTTT
JMFS025E09+ CATAACTAGATTCAATGAGAAGTGCAAGCTGCTCAAATGGCATCATCTTCACTGAGCTTT
                      ____________________________________________________________
consensus CATAACTAGATTCAATGAGAAGTGCAAGCTGCTCAAATGGCATCATCTTCACTGAGCTTT
 
. : . : . : . : . : . :
JMFS161G05+ CATTGATATTTAATACGTTATAAGCATTAGCAAGATGTGAGGTGGTTTTACTCTGCTTAC
JMFS025E09+ CATTGATATTTAATACGTTATAAGCATTAGCAAGATGTGAGGTGGTTTTACTCTGCTTAC
                      ____________________________________________________________
consensus CATTGATATTTAATACGTTATAAGCATTAGCAAGATGTGAGGTGGTTTTACTCTGCTTAC
 
. : . : . : . : . : . :
JMFS161G05+ GGAATTGCCTCCAGCACCTTGCTAATTTTATGGAGAGGTGATCAGCTTGCTCATGCATTT
JMFS025E09+ GGAATTGCCTCCAGCACCTTGCTAATTTTATGGAGAGGTGATCAGCTTGCTCATGCATTT
JMFS072H12+ TATGGAGAGGTGATCAGCTTGCTCATGCATTT
                      ____________________________________________________________
consensus GGAATTGCCTCCAGCACCTTGCTAATTTTATGGAGAGGTGATCAGCTTGCTCATGCATTT
 
. : . : . : . : . : . :
JMFS161G05+ TACTGTAATTGCTGTTAATATGCAGTCTTCCTCTCTGCATCAAATATGCTGCCCTCTGTC
JMFS025E09+ TACTGTAATTGCTGTTAATATGCAGTCTTCCTCTCTGCATCAAATATGCTGCCCTCTGTC
JMFS072H12+ TACTGTAATTGCTGTTAATATGCAGTCTTCCTCTCTGCATCAAATATGCTGCCCTCTGTC
JMFS119D07+ GTAATTGCTGTTAATATGCAGTCTTCCTCTCTGCATCAAATATGCTGCCCTCTGTC
JMFS127E07+ GTTAATATGCAGTCTTCCTCTCTGCATCAAATATGCTGCCCTCTGTC
JMFS130G09+ TCCTCTCTGCATCAGATATGCTGCCCTCTGTC
                      ____________________________________________________________
consensus TACTGTAATTGCTGTTAATATGCAGTCTTCCTCTCTGCATCAAATATGCTGCCCTCTGTC
 
. : . : . : . : . : . :
JMFS161G05+ TCTTTGCCCTCTGTAGTCTGTCTTCTAACTTGTTTTTCATTTCCCTCGTCTTGATCTCTC
JMFS025E09+ TCTTTGCCCTCTGTAGTCTGTCTTCTAACTTGTTTTTCAT-TCCCTCGTCTTGATCTCTC
JMFS072H12+ TCTTTGCCCTCTGTAGTCTGTCTTCTAACTTGTTTTTCATTTCCCTCGTCTTGATCTCTC
JMFS119D07+ TCTTTGCCCTCTGTAGTCTGTCTTCTAACTTGTTTTTCATTTCCCTCGTCTTGATCTCTC
JMFS127E07+ TCTTTGCCCTCTGTAGTCTGTCTTCTAACTTGTTTTTCATTTCCCTCGTCTTGATCTCTC
JMFS130G09+ TCTTTGCCCTCTGTAGTCTGTCTTCTAACTTGTTTTTCATTTCCCTCGTCTTGATCTCTC
JMFS053B12+ TGCCCTCTGTAGTCTGTCTTNNAANNTGTTNTTCATCTCCCTCGTCTTGATTTCTC
                      ____________________________________________________________
consensus TCTTTGCCCTCTGTAGTCTGTCTTCTAACTTGTTTTTCATTTCCCTCGTCTTGATCTCTC
 
. : . : . : . : . : . :
JMFS161G05+ GCTGGTGAGAAA
JMFS025E09+ GCTGGTGAGAAACAGACTTTGCCACTCTTTGTACTTGCATGACCCTATCACAAGCCTTCC
JMFS072H12+ GCTGGTGAGAAACAGACTTTGCCACTCTTTGTACTTGCATGACCCTATCACAAGCCTTCC
JMFS119D07+ GCTGGTGAGAAACAGACTTTGCCACTCTTTGTACTTGCATGACCCTATCACAAGCCTTCC
JMFS127E07+ GCTGGTGAGAAACAGACTTTGCCACTCTTTGTACTTGCATGACCCTATCACAAGCCTTCC
JMFS130G09+ GCTGGTGAGAAACAGACTTTGCCACTCTTTGTACTTGCATGACCCTATCACAAGCCTTCC
JMFS053B12+ GNNGGTGAGAAACAGACTTTGCACTTCTTTGTACTTGCATGACCCTATCACAAGCCTTCC
                      ____________________________________________________________
consensus GCTGGTGAGAAACAGACTTTGCCACTCTTTGTACTTGCATGACCCTATCACAAGCCTTCC
 
. : . : . : . : . : . :
JMFS025E09+ TCTTCTCCGCTTCCAGCAATCCCATTCGCTTCTTTTC
JMFS072H12+ TCTTCTCCGCTTCCAGCAATCCCATTCGCTTCTTTTCCGCTGCCGCACGCTTCTGGCAAA
JMFS119D07+ TCTTCTCCGCTTCCAGCAATCCCATTCGCTTCTTTTCCGCTGCCGCACGCTTCTGGCAAA
JMFS127E07+ TCTTCTCCGCTTCCAGCAATCCCATTCGCTTCTTTTCCGCTGCCGCACGCTTCTGGCAAA
JMFS130G09+ TCTTCTCCGCTTCCAGCAATCCCATTCGCTTCTTTTCCGCTGCCGCACGCTTCTGGCAAA
JMFS053B12+ TTTTCTCCGCTTCCAGCAATCCCATTCGCTTCTTTTCCGCNGCCGCACGCTTTTGGCAAA
                      ____________________________________________________________
consensus TCTTCTCCGCTTCCAGCAATCCCATTCGCTTCTTTTCCGCTGCCGCACGCTTCTGGCAAA
 
. : . : . : . : . : . :
JMFS072H12+ TGGCTGCGCCTACACACTCCTTGTACTTACTTTCTCGAGCGATTCTTCGTAATAATGATT
JMFS119D07+ TGGCTGCGCCTACACACTCCTTGTACTTACTTTCTCGAGCGATTCTTCGTAATAATGATT
JMFS127E07+ TGGCTGCGCCTACACACTCCTTGTACTTACTTTCTCGAGCGATTCTTCGTAATAATGATT
JMFS130G09+ TGGCTGCGCCTACACACTCCTTGTACTTACTTTCTCGAGCGATTCTTCGTAATAATGATT
JMFS053B12+ TGGCTGCGCCTACACACTCCTTGTACTTACTTTCTCGAGCGATTCTTCGTAATAATGATT
JMFS158F08+ AATAATGATT
JMFS106F08+ GCCTACACACTCCTTGTACTTACTTTCTCGAGCGATTCTTCGTAATAATGATT
                      ____________________________________________________________
consensus TGGCTGCGCCTACACACTCCTTGTACTTACTTTCTCGAGCGATTCTTCGTAATAATGATT
 
. : . : . : . : . : . :
JMFS072H12+ GAGATGTCCTCTCCCTCAGAGTAGCCCTCCTTTGGTTATAAGCCTTAAGTATAAGCAACC
JMFS119D07+ GAGATGTCCTCTCCCTCAGAGTAGCCCTCCTTTGGTTATAAGCCTTAAGTATAAGCAACC
JMFS127E07+ GAGATGTCCTCTCCCTCAGAGTAGCCCTCCTTTGGTTATAAGCCTTAAGTATAAGCAACC
JMFS130G09+ GAGATGTCCTCTCCCTCAGAGTAGCCCTCCTTTGGTTATAAGCCTTAAGTATAAGCAACC
JMFS053B12+ GAGATGTCCTCTCCCTCAGAGTAGCCCTCCTTTGGTTATAAGCCTTAAGTATAAGCAACT
JMFS158F08+ GAGATGTCCTCTCCCTCAGAGTAGCCCTCCTTTGGTTATAAGCCTTAAGTATAAGCAACC
JMFS106F08+ GAGATGTCCTCTCCCTCAGAGTAGCCCTCCTTTGGTTATAAGCCTTAAGTATAAGCAACC
                      ____________________________________________________________
consensus GAGATGTCCTCTCCCTCAGAGTAGCCCTCCTTTGGTTATAAGCCTTAAGTATAAGCAACC
 
. : . : . : . : . : . :
JMFS072H12+ TATTAGCCTCAGCCTGCTGAACCCGCAATTCCACTTTGTTACCTAACTCAGCTCGCTCTT
JMFS119D07+ TATTAGCCTCAGCCTGCTGAACCCGCAATTCCACTTTGTTACCTAACTCAGCTCGCTCTT
JMFS127E07+ TATTAGCCTCAGCCTGCTGAACCCGCAATTCCACTTTGTTACCTAACTCAGCTCGCTCTT
JMFS130G09+ TATTAGCCTCAGCCTGCTGAACCCGCAATTCCACTTTGTTACCTAACTCAGCTCGCTCTT
JMFS053B12+ TATTATCCTCAGCCTGCTGAACCCGCAATTCCACTTTGTTACCTAACTCAGCTCGCTCTT
JMFS158F08+ TATTAGCCTCAGCCTGCTGAACCCGCAATTCCACTTTGTTACCTAACTCAGCTCGCTCTT
JMFS106F08+ TATTAGCCTCAGCCTGCTGAACCCGCAATTCCACTTTGTTACCTAACTCAGCTCGCTCTT
                      ____________________________________________________________
consensus TATTAGCCTCAGCCTGCTGAACCCGCAATTCCACTTTGTTACCTAACTCAGCTCGCTCTT
 
. : . : . : . : . : . :
JMFS072H12+ CTCTGAATCGCATTTCTGCTTCAGTTTTAGCTGCTTGCCGCAACTCATGAAGCTTAGCCA
JMFS119D07+ CTCTGAATCGCATTTCTGCTTCAGTTTTAGCTGCTTGCCGCAACTCATGAAGCTTAGCCA
JMFS127E07+ CTCTGAATCGCATTTCTGCTTCAGTTTTAGCTGCTTGCCGCAACTCATGAAGCTTAGCCA
JMFS130G09+ CTCTGAATCGCATTTCTGCTTCAGTTTTAGCTGCTTGCCGCAACTCATGAAGCTTAGCCA
JMFS053B12+ CTNTGAATCGCATTTCTGCTTCAGTTTTAGCTGCTTGCCGCAACTCATGAAGCTTAGCCA
JMFS158F08+ CTCTGAATCGCATTTCTGCTTCAGTTTTAGCTGCTTGCCGCAACTCATGAAGCTTAGCCA
JMFS106F08+ CTCTGAATCGCATTTCTGCTTCAGTTTTAGCTGCTTGCCGCAACTCATGAAGCTTAGCCA
JMFS095G04+ AGCTGCTTGCCGCAACTCATGAAGCTTAGCCA
JMFS018F11+ CAACTCATGAAGCTTAGCCA
JMFS141F02+ TTCAGTTTTAGCTGCTTGCCGCAACTCATGAAGCTTAGCCA
                      ____________________________________________________________
consensus CTCTGAATCGCATTTCTGCTTCAGTTTTAGCTGCTTGCCGCAACTCATGAAGCTTAGCCA
 
. : . : . : . : . : . :
JMFS072H12+ GCCGCATCTGGGCTTTAGCAAGAATGCTCATCCTTTTCTCCTGGGCAGCTTGAAGTTTAG
JMFS119D07+ GCCGCATCTGGGCTTTAGCAAGAATGCTCATCCTTTTCTCCTGGGCAGCTTGAAGTTTAG
JMFS127E07+ GCCGCATCTGGGCTTTAGCAAGAATGCTCATCCTTTTCTCCTGGGCAGCTTGAAGTTTAG
JMFS130G09+ GCCGCATCTGGGCTTTAGCAAGAATGCTCATCCTTTTCTCCTGGGCAGCTTGAAGTTTAG
JMFS053B12+ TCCGCATTTGGGCTTTAGCAAGAATGCTCATCCTTTTCTCCTGGGCAGCTTGAAGTTTAG
JMFS158F08+ GCCGCATCTGGGCTTTAGCAAGAATGCTCATCCTTTTCTCCTGGGCAGCTTGAAGTTTAG
JMFS106F08+ GCCGCATCTGGGCTTTAGCAAGAATGCTCATCCTTTTCTCCTGGGCAGCTTGAAGTTTAG
JMFS095G04+ GCCGCATCTGGGCTTTAGCAAGAATGCTCATCCTTTTCTCCTGGGCAGCTTGAAGTTTAG
JMFS018F11+ GCCGCATCTGGGCTTTAGCAAGAATGCTCATCCTTTTCTCCTGGGCAGCTTGAAGTTTAG
JMFS141F02+ GCCGCATCTGGGCTTTAGCAAGAATGCTCATCCTTTTCTCCTGGGCAGCTTGAAGTTTAG
                      ____________________________________________________________
consensus GCCGCATCTGGGCTTTAGCAAGAATGCTCATCCTTTTCTCCTGGGCAGCTTGAAGTTTAG
 
. : . : . : . : . : . :
JMFS072H12+ CCTCGAGGCGTTGCCCAAGGTCTTCTTCTCCAGCCATAGATTGTGTGGGGCTTCG
JMFS119D07+ CCTCGAGGCGTTGCCCAAGGTCTTCTTCTCCAGCCATAGATTGTGTGGGGCTTCGTGGCT
JMFS127E07+ CCTCGAGGCGTTGCCCAAGGTCTTCTTCTCCAGCCATAGATTGTGTGGGGCTTCGTGGCT
JMFS130G09+ CCTCGAGGCGTTGCCCAAGGTCTTCTTCTCCAGCCATAGATTGTGTGGGGCTTCGTGGCT
JMFS053B12+ CCTCGAGGCGTTGCCCAAGGTCTTCTTCTCCAGCCATAGATTGTGTGGGGCTTCGTGGCT
JMFS158F08+ CCTCGAGGCGTTGCCCAAGGTCTTCTTCTCCAGCCATAGATTGTGTGGGGCTTCGTGGCT
JMFS106F08+ GCTCGAGGCGTTGCCCAAGGTCTTCTTCTCCAGCCATAGATTGTGTGGGGCTTCGTGGCT
JMFS095G04+ CCTCGAGGCGTTGCCCAAGGTCTTCTTCTCCAGCCATAGATTGTGTGGGGCTTCGTGGCT
JMFS018F11+ CCTCGAGGCGTTGCCCAAGGTCTTCTTCTCCAGCCATAGATTGTGTGGGGCTTCGTGGCT
JMFS141F02+ CCTCGAGGCGTTGCCCAAGGTCTTCTTCTCCAGCCATAGATTGTGTGGGGCTTCGTGGCT
                      ____________________________________________________________
consensus CCTCGAGGCGTTGCCCAAGGTCTTCTTCTCCAGCCATAGATTGTGTGGGGCTTCGTGGCT
 
. : . : . : . : . : . :
JMFS119D07+ TCGGCCTGGCTTTACTTGACAGATACTCATA
JMFS127E07+ TCGGCCTGGCTTTACTTGACAGATACTCATAGAATT
JMFS130G09+ TCGGCCTGGCTTTACTTGACAGATACTCATAGAATTTCT
JMFS053B12+ TCGGCCTGGCTTTACTTGACAGATACTCATAGAATTTCT
JMFS158F08+ TCGGCCTGGCTTTACTTGACAGATACTCATAGAATTTCTGTCGACGAAGATCGG
JMFS106F08+ TCGGCCTGGCTTTACTTGACAGATACTCATAGAATTTCTGTCGACGAAGATCGGCTCCGC
JMFS095G04+ TCGGCCTGGCTTTACTTGACAGATACTCATAGAATTTCTGTCGACGAAGATCGGCTCCGC
JMFS018F11+ TCGGCCTGGCTTTACTTGACAGATACTCATAGAATTTCTGTCGACGAAGATCGGCTCCGC
JMFS141F02+ TCGGCCTGGCTTTACTTGACAGATACTCATAGAATTTCTGTCGACGAAGATCGGCTCCGC
JMFS027C03+ GCTTTACTTGACAGATACTCATAGAATTTCTGTCGACGAAGATCGGCTCCGC
                      ____________________________________________________________
consensus TCGGCCTGGCTTTACTTGACAGATACTCATAGAATTTCTGTCGACGAAGATCGGCTCCGC
 
. : . : . : . : . : . :
JMFS106F08+ GAAGTTTGGCTTCGATTTCTTCAACAGTAGGCGGAGAGGTTTTGGCCTCCGACAGCTTCT
JMFS095G04+ GAAGTTTGGCTTCGATTTCTTCAACAGTAGGCGGAGAGGTTTTGGCCTCCGACAGCTTCT
JMFS018F11+ GAAGTTTGGCTTCGATTTCTTCAACAGTAGGCGGAGAGGTTTTGGCCTCCGACAGCTTCT
JMFS141F02+ GAAGTTTGGCTTCGATTTCTTCAACAGTAGGCGGAGAGGTTTTGGCCTCCGACAGCTTCT
JMFS027C03+ GAAGTTTGGCTTCGATTTCTTCAACAGTAGGCGGAGAGGTTTTGGCCTCCGACAGCTTCT
                      ____________________________________________________________
consensus GAAGTTTGGCTTCGATTTCTTCAACAGTAGGCGGAGAGGTTTTGGCCTCCGACAGCTTCT
 
. : . : . : . : . : . :
JMFS106F08+ GGCGAAGCCAAGGCGGAATAGTCGGCGGGGACAGCGACGTCGCTCCATCATCGGACGCCG
JMFS095G04+ GGCGAAGCCAAGGCGGAATAGTCGGCGGGGACAGCGACGTCGCTCCATCATCGGACGCCG
JMFS018F11+ GGCGAAGCCAAGGCGGAATAGTCGGCGGGGACAGCGACGTCGCTCCATCATCGGACGCCG
JMFS141F02+ GGCGAAGCCAAGGCGGAATAGTCGGCGGGGACAGCGACGTCGCTCCATCATCGGACGCCG
JMFS160D03+ GCTCCATCATCGGACGCCG
JMFS160D02+ CGAAGCCAAGGCGGAATAGTCGGCGGGGACAGCGACGTCGCTCCATCATCGGACGCCG
JMFS027C03+ GGCGAAGCCAAGGCGGAATAGTCGGCGGGGACAGCGACGTCGCTCCATCATCGGACGCCG
                      ____________________________________________________________
consensus GGCGAAGCCAAGGCGGAATAGTCGGCGGGGACAGCGACGTCGCTCCATCATCGGACGCCG
 
. : . : . : . : . : . :
JMFS106F08+ GAATCTCCATCGCTACTCCTCCAGCCACCACCACCATCTCCGGAGACTCTACTCCCATCT
JMFS095G04+ GAATCTCCATCGCTACTCCTCCAGCCACCACCACCATCTCCGGAGACTCTACTCCCATCT
JMFS018F11+ GAATCTCCATCGCTACTCCTCCAGCCACCACCACCATCTCCGGAGACTCTACTCCCATCT
JMFS141F02+ GAATCTCCATCGCTACTCCTCCAGCCACCACCACCATCTCCGGAGACTCTACTCCCATCT
JMFS160D03+ GAATCTCCATCGNTACTCCTCCAGCCACCACCACCATCTCCGGAGACTCTACTCCCATCT
JMFS160D02+ GAATCTCCATCGNTACTCCTCCAGCCACCACCACCATCTCCGGAGACTCTACTCCCATCT
JMFS027C03+ GAATCTCCATCGCTACTCCTCCAGCCACCACCACCATCTCCGGAGACTCTACTCCCATCT
                      ____________________________________________________________
consensus GAATCTCCATCGCTACTCCTCCAGCCACCACCACCATCTCCGGAGACTCTACTCCCATCT
 
. : . : . : . : . : . :
JMFS106F08+ CCATCACCAACCAAACAATTTATATTCCA
JMFS095G04+ CCATCACCAACCAAACAATTTATATTCCAGAGAGAATTCCACAATTTCAACTTCAACACT
JMFS018F11+ CCATCACCAACCAAACAATTTATATTCCAGAGAGAATTCCACAATTTCAACTTCAACACT
JMFS141F02+ CCATCACCAACCAAACAATTTATATTCCAGAGAGAATTCCACAATTTCAACTTCAACACT
JMFS160D03+ CCATCACCAACCAAACAATTTATATTCCAGAGAGAATTCCACAACCCCAACTTCAACACT
JMFS160D02+ CCATCACCAACCAAACAATTTATATTCCAGAGAGAATTCCACAATCTCAACTTCAACACT
JMFS156D11+ AACCAAACAATTTATATTCCAGAGAGAATTCCACAATTTCAACTTCAACACT
JMFS027C03+ CCATCACCAACCAAACAATTTATATTCCAGAGAGAATTCCACAATTTCAACTTCAACACT
                      ____________________________________________________________
consensus CCATCACCAACCAAACAATTTATATTCCAGAGAGAATTCCACAATTTCAACTTCAACACT
 
. : . : . : . : . : . :
JMFS095G04+ GATCAATCAATCGATCAATTCACAGTATACACACACACACACACACAAAAGAATCCAGAA
JMFS018F11+ GATCAATCAATCGATCAATTCACAGTATACACACACACACACACACAAAAGAATCCAGAA
JMFS141F02+ GATCAATCAATCGATCAATTCACAGTATACACACACACACACACACAAAAGAATCCAGAA
JMFS160D03+ GATCAATCAATCGATCAATTCACAGTATACACACACACACACACACAAAAGAATCCAGAA
JMFS160D02+ GATCAATCAATCGATCAATTCACAGTATACACACACACACACACACAAAAGAATCCAGAA
JMFS156D11+ GATCAATCAATCGATCAATTCACAGTATACACACACACACACACACAAAAGAATCCAGAA
JMFS027C03+ GATCAATCAATCGATCAATTCACAGTATACACACACACACACACACAAAAGAATCCAGAA
                      ____________________________________________________________
consensus GATCAATCAATCGATCAATTCACAGTATACACACACACACACACACAAAAGAATCCAGAA
 
. : . : . : . : . : . :
JMFS095G04+ AAATAATAAAATACACAGCAGCTTTTGTATATCTATTCTCAGAGGATTAAAGAGATTGGA
JMFS018F11+ AAATAATAAAATACACAGCAGCTTTTGTATATCTATTCTCAGAGGATTAAAGAGATTGGA
JMFS141F02+ AAATAATAAAATACACAGCAGCTTTTGTATATCTATTCTCAGAGGATTAAAGAGATTGGA
JMFS160D03+ AAATAATAAAATACACAGCAGCTTTTGTATATCTATTCTCAGAGGATTAAAGAGATTGGA
JMFS160D02+ AAATAATAAAATACACAGCAGCTTTTGTATATCTATTCTCAGAGGATTAAAGAGATTGGA
JMFS156D11+ AAATAATAAAATACACAGCAGCTTTTGTATATCTATTCTCAGAGGATTAAAGAGATTGGA
JMFS027C03+ AAATAATAAAATACACAGCAGCTTTTGTATATCTATTCTCAGAGGATTAAAGAGATTGGA
                      ____________________________________________________________
consensus AAATAATAAAATACACAGCAGCTTTTGTATATCTATTCTCAGAGGATTAAAGAGATTGGA
 
. : . : . : . : . : . :
JMFS095G04+ GCAAGATTGAAAAGAAATTAAGAGAGAGAGA
JMFS018F11+ GCAAGATTGAAAAGAAATTAAGAGAGAGAGAGAGA
JMFS141F02+ GCAAGATTGAAAAGAAATTAAGAGAGAGAGAGAGAGAT
JMFS160D03+ GCAAGATTGAAAAGAAATTAAGAGAGAGAGAGAGAGATGGAGCTCT
JMFS160D02+ GCAAGATTGAAAAGAAATTAAGAGAGAGAGAGAGAGATGGAGCTCT
JMFS156D11+ GCAAGATTGAAAAGAAATTAAGAGAGAGAGAGAGAGATGGAGCTCTGAGAGTT
JMFS027C03+ GCAAGATTGAAAAGAAATTAAGAGAGAGAGAGAGAGATGGAGCTCTGAGAGTTTGGGTAT
                      ____________________________________________________________
consensus GCAAGATTGAAAAGAAATTAAGAGAGAGAGAGAGAGATGGAGCTCTGAGAGTTTGGGTAT
 
. : . : . : . : . : . :
JMFS027C03+ AGTTCTGAATTCTGATACTCTTTCCCCTTTCGCATTTGTTATAGAAGCCTCCCAAAAGGA
                      ____________________________________________________________
consensus AGTTCTGAATTCTGATACTCTTTCCCCTTTCGCATTTGTTATAGAAGCCTCCCAAAAGGA