Previous Contig 003069:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010H15Sequence539003069 (6)gb:BT010150_16402166e-59Arabidopsis thaliana At1g34220 gene, complete cds.664008649 (6)gb:BT010150_16402167e-06Arabidopsis thaliana At1g34220 gene, complete cds.
JMFF011C04Sequence568003069 (6)pir|E86466|E864662e-71protein F23M19.10 [imported] - Arabidopsis thaliana>gb:AE005172_892225 Arabidops763008649 (6)gb:BT010150_16402169e-06Arabidopsis thaliana At1g34220 gene, complete cds.
JMFF020F07Sequence496003069 (6)gb:BT010150_16402164e-48Arabidopsis thaliana At1g34220 gene, complete cds.689008649 (6)sp|P04929|HRPX_PLALO7e-06Histidine-rich glycoprotein precursor.>pir|A22692|KGZQHL histidine-rich glycopro
JMFF022J11Sequence533003069 (6)pir|E86466|E864668e-69protein F23M19.10 [imported] - Arabidopsis thaliana>gb:AE005172_892225 Arabidops759008649 (6)sp|P04929|HRPX_PLALO6e-07Histidine-rich glycoprotein precursor.>pir|A22692|KGZQHL histidine-rich glycopro
JMFF024M07Sequence448003069 (6)gb:BT010150_16402162e-53Arabidopsis thaliana At1g34220 gene, complete cds.695008649 (6)gb:BT010150_16402168e-06Arabidopsis thaliana At1g34220 gene, complete cds.
JMFS026H08Sequence616003069 (6)gb:BT010150_16402166e-56Arabidopsis thaliana At1g34220 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF011C04+ TCTAGCTCATGCTCCTCAGCAAT
                      ____________________________________________________________
consensus TCTAGCTCATGCTCCTCAGCAAT
 
. : . : . : . : . : . :
JMFF011C04+ TTCCTTCAGGACCTTCAGTTTCACATCAGGAGCAGGAGCACGAATAGAAAGCAGCTCTAT
JMFF022J11+ TTCACATCAGGAGCAGGAGCACGAATAGAAAGCAGCTCTAT
                      ____________________________________________________________
consensus TTCCTTCAGGACCTTCAGTTTCACATCAGGAGCAGGAGCACGAATAGAAAGCAGCTCTAT
 
. : . : . : . : . : . :
JMFF024M07+ GTGGCAGCAGCAACAAATTCTTT
JMFF011C04+ CAACTGGCGATTGACACCACATTCAGGCCTAAGCTCTGTGGCAGCAGCAACAAATTCTTT
JMFF022J11+ CAACTGGCGATTGACACCACATTCAGGCCTAAGCTCTGTGGCAGCAGCAACAAATTCTTT
JMFF010H15+ GTGGCAGCAGCAACAAATTCTTT
JMFS026H08+ CAGCAACAAATTCTTT
                      ____________________________________________________________
consensus CAACTGGCGATTGACACCACATTCAGGCCTAAGCTCTGTGGCAGCAGCAACAAATTCTTT
 
. : . : . : . : . : . :
JMFF024M07+ TCCATATTTACCAGTAAAAGCCAGTTGAACCTGCTGCAACTCTGGAAGATCGGCACATCT
JMFF011C04+ TCCATATTTACCAGTAAAAGCCAGTTGAACCTGCTGCAACTCTGGAAGATCGGCACATCT
JMFF022J11+ TCCATATTTACCAGTAAAAGCCAGTTGAACCTGCTGCAACTCTGGAAGATCGGCACATCT
JMFF010H15+ TCCATATTTACCAGTAAAAGCCAGTTGAACCTGCTGCAACTCTGGAAGATCGGCACATCT
JMFF020F07+ GAAGATCGGCACATCT
JMFS026H08+ TCCATATTTACCAGTAACAGCCAGTTGAACCTGCTGCAACTCTGGAAGATCGGCACATCT
                      ____________________________________________________________
consensus TCCATATTTACCAGTAAAAGCCAGTTGAACCTGCTGCAACTCTGGAAGATCGGCACATCT
 
. : . : . : . : . : . :
JMFF024M07+ TGGTGCAGCAAAACATACACTGGAAATTGCTTC-TTCAAATCCAGGGGGCATTCCCTTTG
JMFF011C04+ TGGTGCAGCAAAACATACACTGGAAATTGCTTC-TTCAAATCCAGGGGGCATTCCCTTTG
JMFF022J11+ TGGTGCAGCAAAACATACACTGGAAATTGCTTCTTTCAAATCCAGGGGGCATTCCCTTTG
JMFF010H15+ TGGTGCAGCAAAACATACACTGGAAATTGCTTCTTTCAAATCCAGGGGGCATTCCCTTTG
JMFF020F07+ TGGTGCAGCAAAACATACACTGGAAATTGCTTCTTTCAAATCCAGGGGGCATTCCCTTTG
JMFS026H08+ TGGTGCAGCAAAACATACACTGGAAATTGCTTCTTTCAAATCCAGGGGGCATTCCCTTTG
                      ____________________________________________________________
consensus TGGTGCAGCAAAACATACACTGGAAATTGCTTCTTTCAAATCCAGGGGGCATTCCCTTTG
 
. : . : . : . : . : . :
JMFF024M07+ TGCCTCAATTATTGGAAGACGAACACTTATGAGCTCACAAAATAGCTCAATTATCTCCTG
JMFF011C04+ TGCCTCAATTATTGGAAGACGAACACTTATGAGCTCACAAAATAGCTCAATTATCTCCTG
JMFF022J11+ TGCCTCAATTATTGGAAGACGAACACTTATGAGCTCACAAAATAGCTCAATTATCTCCTG
JMFF010H15+ TGCCTCAATTATTGGAAGACGAACACTTATGAGCTCACAAAATAGCTCAATTATCTCCTG
JMFF020F07+ TGCCTCAATTATTGGAAGACGAACACTTATGAGCTCACAAAATAGCTCAATTATCTCCTG
JMFS026H08+ TGCCTCAATTATTGGAAGACGAACACTTATGAGCTCACAAAATAGCTCAATTATCTCCTG
                      ____________________________________________________________
consensus TGCCTCAATTATTGGAAGACGAACACTTATGAGCTCACAAAATAGCTCAATTATCTCCTG
 
. : . : . : . : . : . :
JMFF024M07+ GGCAGCCATCATTTTCTCCTCTCTTATAATATGCTCCACCCGAATCCGAGCAGTGGCTTC
JMFF011C04+ GGCAGCCATCATTTTCTCCTCTCTTATAATATGCTCCACCCGAATCCGAGCAGTGGCTTC
JMFF022J11+ GGCAGCCATCATTTTCTCCTCTCTTATAATATGCTCCACCCGAATCCGAGCAGTGGCTTC
JMFF010H15+ GGCAGCCATCATTTTCTCCTCTCTTATAATATGCTCCACCCGAATCCGAGCAGTGGCTTC
JMFF020F07+ GGCAGCCATCATTTTCTCCTCTCTTATAATATGCTCCACCCGAATCCGAGCAGTGGCTTC
JMFS026H08+ GGCAGCCATCATTTTCTCCTCTCTTATAATATGCTCCACCCGAATCCGAGCAGTGGCTTC
                      ____________________________________________________________
consensus GGCAGCCATCATTTTCTCCTCTCTTATAATATGCTCCACCCGAATCCGAGCAGTGGCTTC
 
. : . : . : . : . : . :
JMFF024M07+ CTGACCAGTTTCAAGAAGCTTGGCAATTTCTTTCCGCATCTGCTTCAGCTGAATCTCTCT
JMFF011C04+ CTGACCAGTTTCAAGAAGCTTGGCAATTTCTTTCCGCATCTGCTTCAGCTGAATCTCTCT
JMFF022J11+ CTGACCAGTTTCAAGAAGCTTGGCAATTTCTTTCCGCATCTGCTTCAGCTGAATCTCTCT
JMFF010H15+ CTGACCAGTTTCAAGAAGCTTGGCAATTTCTTTCCGCATCTGCTTCAGCTGAATCTCTCT
JMFF020F07+ CTGACCAGTTTCAAGAAGCTTGGCAATTTCTTTCCGCATCTGCTTCAGCTGAATCTCTCT
JMFS026H08+ CTGACCAGTTTCAAGAAGCTTGGCAATTTCTTTCCGCATCTGCTTCAGCTGAATCTCTCT
                      ____________________________________________________________
consensus CTGACCAGTTTCAAGAAGCTTGGCAATTTCTTTCCGCATCTGCTTCAGCTGAATCTCTCT
 
. : . : . : . : . : . :
JMFF024M07+ ACGGTTTCTCAATAGCTTTATCCGAGGGATCGTCAGCTTCAATAGAGTTTTACATTTGGC
JMFF011C04+ ACGGTTTCTCAATAGCTTTATCCGAGGGATCGTCAGCTTCAATAGAGTTTTACATTTGGC
JMFF022J11+ ACGGTTTCTCAATAGCTTTATCCGAGGGATCGTCAGCTTCAATAGAGTTTTACATTTGGC
JMFF010H15+ ACGGTTTCTCAATAGCTTTATCCGAGGGATCGTCAGCTTCAATAGAGTTTTACATTTGGC
JMFF020F07+ ACGGTTTCTCAATAGCTTTATCCGAGGGATCGTCAGCTTCAATAGAGTTTTACATTTGGC
JMFS026H08+ ACGGTTTCTCAATAGCTTTATCCGAGGGATCGTCAGCTTCAATAGAGTTTTACATTTGGC
                      ____________________________________________________________
consensus ACGGTTTCTCAATAGCTTTATCCGAGGGATCGTCAGCTTCAATAGAGTTTTACATTTGGC
 
. : . : . : . : . : . :
JMFF024M07+ AGCTTTGAAGCCTTTGTTGAAGAAGGAATCCATCTCGTTTCTATGAGCGCGTCTTGGAAG
JMFF011C04+ AGCTTTGAAGCCTTTGTTGAAGAAGGAATCCATCTCGTTTCTATGAGCGCGTCTTGGAAG
JMFF022J11+ AGCTTTGAAGCCTTTGTTGAAGAAGGAATCCATCTCGTTTCTATGAGCGCGTCTTGGAAG
JMFF010H15+ AGCTTTGAAGCCTTTGTTGAAGAAGGAATCCATCTCGTTTCTATGAGCGCGTCTTGGAAG
JMFF020F07+ AGCTTTGAAGCCTTTGTTGAAGAAGGAATCCATCTCGTTTCTATGAGCGCGTCTTGGAAG
JMFS026H08+ AGCTTTGAAGCCTTTGTTGAAGAAGGAATCCATCTCGTTTCTATGAGCGCGTCTTGGAAG
                      ____________________________________________________________
consensus AGCTTTGAAGCCTTTGTTGAAGAAGGAATCCATCTCGTTTCTATGAGCGCGTCTTGGAAG
 
. : . : . : . : . : . :
JMFF024M07+ CAAATT
JMFF011C04+ CAAATT
JMFF022J11+ CAAATTGGTCAC
JMFF010H15+ CAAATTGGTCACGAAAACTATAGCGATTCAGACTGGTTTATAAGGGAATGATGAGAAACG
JMFF020F07+ CAAATTGGTCACGAAAACTATAGCGATTCAGACTGGTTTATAAGGGAATGATGAGAAACG
JMFS026H08+ CAAATTGGTCACGAAAACTATAGCGATTCAGACTGGTTTATAAGGGAATGATGAGAAACG
                      ____________________________________________________________
consensus CAAATTGGTCACGAAAACTATAGCGATTCAGACTGGTTTATAAGGGAATGATGAGAAACG
 
. : . : . : . : . : . :
JMFF010H15+ GAGTAGACGCGTCCGACGAAGGTGCCAAC
JMFF020F07+ GAGTAGACGCGTCCGACGAAGGTGCCAACAAGAAGAAACGATATGGTGATTAGTGATTAC
JMFS026H08+ GAGTAGACGCGTCCGACGAAGGTGCCAACAAGAAGAAACGATATGGTGATTAGTGATTAC
                      ____________________________________________________________
consensus GAGTAGACGCGTCCGACGAAGGTGCCAACAAGAAGAAACGATATGGTGATTAGTGATTAC
 
. : . : . : . : . : . :
JMFS026H08+ GACTGCAAGTCCTCAGTTTTCTTACGGCTTAAGGGATCTTTTTTTCAACCCGCCTCTCAA
                      ____________________________________________________________
consensus GACTGCAAGTCCTCAGTTTTCTTACGGCTTAAGGGATCTTTTTTTCAACCCGCCTCTCAA