Previous Contig 003065:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS026D08Sequence626003065 (2)pir|T48079|T480793e-06hypothetical protein F26K9.330 - Arabidopsis thaliana>gb:ATF26K9_1550137 Arabido
JMFS095F04Sequence616003065 (2)pir|T48079|T480793e-04hypothetical protein F26K9.330 - Arabidopsis thaliana>gb:ATF26K9_1550137 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS095F04+ TTCCACTATTACCAT
                      ____________________________________________________________
consensus TTCCACTATTACCAT
 
. : . : . : . : . : . :
JMFS095F04+ GAAGACCATCATTCCTTCTTCCCTTGTCTTGGCCTCGTTCCAAATTCTGTGTTTTGGAAG
                      ____________________________________________________________
consensus GAAGACCATCATTCCTTCTTCCCTTGTCTTGGCCTCGTTCCAAATTCTGTGTTTTGGAAG
 
. : . : . : . : . : . :
JMFS095F04+ CATACTGGTCACATTGAGGCAAGGGTTCTACAGCCGCATTTTCATCATGTGTTACAATAA
                      ____________________________________________________________
consensus CATACTGGTCACATTGAGGCAAGGGTTCTACAGCCGCATTTTCATCATGTGTTACAATAA
 
. : . : . : . : . : . :
JMFS095F04+ CAGGAGAAGGTGCAGTGTCTCGCCTCACTTTAGCATATGATATATGACCCAAATCTGCTT
                      ____________________________________________________________
consensus CAGGAGAAGGTGCAGTGTCTCGCCTCACTTTAGCATATGATATATGACCCAAATCTGCTT
 
. : . : . : . : . : . :
JMFS095F04+ CCTGGCAATCAAGAGAACCATTATGCCCAGCATTCAAAGTTTCGCCCTTCTTAATCATTC
JMFS026D08+ CAAAGTTTCGCCCTTCTTAATCATTC
                      ____________________________________________________________
consensus CCTGGCAATCAAGAGAACCATTATGCCCAGCATTCAAAGTTTCGCCCTTCTTAATCATTC
 
. : . : . : . : . : . :
JMFS095F04+ CAGATTGATCACTGCCCCCATCATTTTCTCCATCTGAAGATCTCCGAGGAGTAAGCACGG
JMFS026D08+ CAGATTGATCACTGCCNCCATCATTTTCTCCATCTGAAGATCTCCGAGGAGTAAGCACGG
                      ____________________________________________________________
consensus CAGATTGATCACTGCCCCCATCATTTTCTCCATCTGAAGATCTCCGAGGAGTAAGCACGG
 
. : . : . : . : . : . :
JMFS095F04+ ATAATGATCCTGCATCCTGACAATCATTTCTTCTTGTTGAGGTGAATTTATCTACAGTAG
JMFS026D08+ ATAATGATCCTGCATCCTGACAATCATTTCTTCTTGTTGAGGTGAATTTATCTACAGTAG
                      ____________________________________________________________
consensus ATAATGATCCTGCATCCTGACAATCATTTCTTCTTGTTGAGGTGAATTTATCTACAGTAG
 
. : . : . : . : . : . :
JMFS095F04+ GAATCCTCAGAGGAGATGAAGACACTGACTCTACAGGAGAAGCCCTCAGTTCCTGGAGAT
JMFS026D08+ GAATCCTCAGAGGAGATGAAGACACTGACTCTACAGGAGAAGCCCTCAGTTCCTGGAGAT
                      ____________________________________________________________
consensus GAATCCTCAGAGGAGATGAAGACACTGACTCTACAGGAGAAGCCCTCAGTTCCTGGAGAT
 
. : . : . : . : . : . :
JMFS095F04+ TGCTTTTGTTTCTTTGTGAACCAGAAACTTTAGAAGAACTTGAAGTGGCAGCCATGGAAG
JMFS026D08+ TGCTTTTGTTTCTTTGTGAACCAGAAACTTTAGAAGAACTTGAAGTGGCAGCCATGGAAG
                      ____________________________________________________________
consensus TGCTTTTGTTTCTTTGTGAACCAGAAACTTTAGAAGAACTTGAAGTGGCAGCCATGGAAG
 
. : . : . : . : . : . :
JMFS095F04+ GCTGCAGAGTGCCCAAATGCCTTTTTGAAGAATCCATAGCATCTATGGTCTGCTGAGACT
JMFS026D08+ GCTGCAGAGTGCCCAAATGCCTTTTTGAAGAATCCATAGCATCTATGGTCTGCTGAGACT
                      ____________________________________________________________
consensus GCTGCAGAGTGCCCAAATGCCTTTTTGAAGAATCCATAGCATCTATGGTCTGCTGAGACT
 
. : . : . : . : . : . :
JMFS095F04+ GAGTGCAATCCAGATACTGCCCTATTTGCTGGTCCTTATTTCTAACCCTTTCGTCTTTTC
JMFS026D08+ GAGTGCAATCCAGATACTGCCCTATTTGCTGGTCCTTATTTCTAACCCTTTCGTCTTTTC
                      ____________________________________________________________
consensus GAGTGCAATCCAGATACTGCCCTATTTGCTGGTCCTTATTTCTAACCCTTTCGTCTTTTC
 
. : . : . : . : . : . :
JMFS095F04+ C
JMFS026D08+ CTTCATTGGCTTTGTTTCCACTAGAATCTTTCACCTCAGATTTGGATACCCTTGCTCTCT
                      ____________________________________________________________
consensus CTTCATTGGCTTTGTTTCCACTAGAATCTTTCACCTCAGATTTGGATACCCTTGCTCTCT
 
. : . : . : . : . : . :
JMFS026D08+ TTTCTTTTCTTTGGCCATTTTCACAAGTTTCTTCAAGCAAACCAACAGAATCTTGAGAGT
                      ____________________________________________________________
consensus TTTCTTTTCTTTGGCCATTTTCACAAGTTTCTTCAAGCAAACCAACAGAATCTTGAGAGT
 
. : . : . : . : . : . :
JMFS026D08+ TGCATCCTAAACCAGGAAATGACCTACTGTTGGCCTCTGAATGGTGATACCCATTCCCCT
                      ____________________________________________________________
consensus TGCATCCTAAACCAGGAAATGACCTACTGTTGGCCTCTGAATGGTGATACCCATTCCCCT
 
. : . : . : . : . : . :
JMFS026D08+ TCCTCCTCCTCTTAGAAGAGTCTTTACTGTTAGACTTGCCAGCATGTAGTGATCCATCAC
                      ____________________________________________________________
consensus TCCTCCTCCTCTTAGAAGAGTCTTTACTGTTAGACTTGCCAGCATGTAGTGATCCATCAC