Previous Contig 003063:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS026C12Sequence609003063 (2)
JMSF036L02Sequence685003063 (2)pir|T49218|T492187e-09hypothetical protein F27H5.20 - Arabidopsis thaliana>gb:ATF27H5_1550216 Arabidop738023731gb:CP000029_828590.009Staphylococcus epidermidis RP62A, complete genome.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036L02+ GGAACCTGCATCCCATTCATGAAACTAGGATTTAACGACCCAAACTGAAGAGGGAAG
                      ____________________________________________________________
consensus GGAACCTGCATCCCATTCATGAAACTAGGATTTAACGACCCAAACTGAAGAGGGAAG
 
. : . : . : . : . : . :
JMSF036L02+ GACTTAGATCCATCTCCTGGAGCTTTAGAAGTGCCTGGTGCATTAGGGTCTGGACCAGCA
JMFS026C12+ GGACCAGCA
                      ____________________________________________________________
consensus GACTTAGATCCATCTCCTGGAGCTTTAGAAGTGCCTGGTGCATTAGGGTCTGGACCAGCA
 
. : . : . : . : . : . :
JMSF036L02+ GAGGAATTGGAGGGTGGAGGTCTAGGTACAGCTCTGTTAATTTTTTGTGTTGGTGCATTA
JMFS026C12+ GAGGAATTGGAGGGTGGAGGTCTAGGTACAGCTCTGTTAATTTTTTGTGTTGGTGCATTA
                      ____________________________________________________________
consensus GAGGAATTGGAGGGTGGAGGTCTAGGTACAGCTCTGTTAATTTTTTGTGTTGGTGCATTA
 
. : . : . : . : . : . :
JMSF036L02+ CTGACATTAACAGGAGTACCCAAAGGAGGGACACCTGCAGTAGTAATAGGTGCAGCATCT
JMFS026C12+ CTGACATTAACAGGAGTACCCAAAGGAGGGACACCTGCAGTAGTAATAGGTGCAGCATCT
                      ____________________________________________________________
consensus CTGACATTAACAGGAGTACCCAAAGGAGGGACACCTGCAGTAGTAATAGGTGCAGCATCT
 
. : . : . : . : . : . :
JMSF036L02+ AAAACTTCACTTAATGGCTGTTCTTGGTGAGCACCATTCTGCACTCCTCTAGCAGAGCTC
JMFS026C12+ AAAACTTCACTTAATGGCTGTTCTTGGTGAGCACCATTCTGCACTCCTCTAGCAGAGCTC
                      ____________________________________________________________
consensus AAAACTTCACTTAATGGCTGTTCTTGGTGAGCACCATTCTGCACTCCTCTAGCAGAGCTC
 
. : . : . : . : . : . :
JMSF036L02+ CCACTTGGATCACTTGCTACCCGATATCCTCCTTGTGCATTATTATACTTCTTGTTGAAG
JMFS026C12+ CCACTTGGATCACTTGCTACCCGATATCCTCCTTGTGCATTATTATACTTCTTGTTGAAG
                      ____________________________________________________________
consensus CCACTTGGATCACTTGCTACCCGATATCCTCCTTGTGCATTATTATACTTCTTGTTGAAG
 
. : . : . : . : . : . :
JMSF036L02+ CTTCTGTTGTAAGACGAGGAGGGACTAGGAGCAGGGGCAGAGCCACTGCCACCTCCGCCG
JMFS026C12+ CTTCTGTTGTAAGACGAGGAGGGACTAGGAGCAGGGGCAGAGCCACTGCCACCTCCGCCG
                      ____________________________________________________________
consensus CTTCTGTTGTAAGACGAGGAGGGACTAGGAGCAGGGGCAGAGCCACTGCCACCTCCGCCG
 
. : . : . : . : . : . :
JMSF036L02+ CCGCCGCCGCCGCCTTTACTACCGCGATACTGATTGAAGCTGCCGGATCGTCCAGGCCTC
JMFS026C12+ CCGCCGCCGCCGCCTTTACTACCGCGATACTGATTGAAGCTGCCGGATCGTCCAGGCCTC
                      ____________________________________________________________
consensus CCGCCGCCGCCGCCTTTACTACCGCGATACTGATTGAAGCTGCCGGATCGTCCAGGCCTC
 
. : . : . : . : . : . :
JMSF036L02+ CTGTTCTGATAAGAGTCGCGACTTTCCGACCTCGATTGATTATGGGACATATATCCAAAA
JMFS026C12+ CTGTTCTGATAAGAGTCGCGACTTTCCGACCTCGATTGATTATGGGACATATATCCAAAA
                      ____________________________________________________________
consensus CTGTTCTGATAAGAGTCGCGACTTTCCGACCTCGATTGATTATGGGACATATATCCAAAA
 
. : . : . : . : . : . :
JMSF036L02+ CGTCGACGACAGCAGTTTTACTGGAGTGAAAGGAAGTGTTGCTGTGCAAAAATTAGGGCT
JMFS026C12+ CGTCGACGACAGCAGTTTTACTGGAGTGAAAGGAAGTGTTGCTGTGCAAAAATTAGGGCT
                      ____________________________________________________________
consensus CGTCGACGACAGCAGTTTTACTGGAGTGAAAGGAAGTGTTGCTGTGCAAAAATTAGGGCT
 
. : . : . : . : . : . :
JMSF036L02+ TTAATGTCAGTGGCGATCGGCGGCAACCAGAAGCACCACCGCACCCATACGATATACAAA
JMFS026C12+ TTAATGTCAGTGGCGATCGGCGGCAACCAGAAGCACCACCGCACCCATACGATATACAAA
                      ____________________________________________________________
consensus TTAATGTCAGTGGCGATCGGCGGCAACCAGAAGCACCACCGCACCCATACGATATACAAA
 
. : . : . : . : . : . :
JMSF036L02+ CAGCGAGCAGAGAAGATGTGAGCGAGC
JMFS026C12+ CAGCGAGCAGAGAAGATGTGAGCGAGCGTTTGTGTTGTTGTTTGGTGCGTACAAATACAG
                      ____________________________________________________________
consensus CAGCGAGCAGAGAAGATGTGAGCGAGCGTTTGTGTTGTTGTTTGGTGCGTACAAATACAG